1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ankoles [38]
3 years ago
8

Which question is scientifically testable allowing a conclusion to be made based on scientific evidence?

Biology
1 answer:
sineoko [7]3 years ago
4 0

Answer: C) Is gold heavier than silver?

Explanation: .-.

You might be interested in
PLEASE GELP ME I NEED ANSWERS
aleksandr82 [10.1K]

B. Deposition

Deposition is the dropping of sediment by wind, water, ice, or gravity.

3 0
3 years ago
Read 2 more answers
The central dogma describes how the genes in the nucleus work to produce an organism's phenotype. another way of putting it is t
77julia77 [94]
Due to the definition of the central dogma, another way of putting it is that the central dogma follows the flow of information from DNA to protein.
7 0
3 years ago
Can somebody give me a list of decomposers? Also a definition?
konstantin123 [22]
Worms, Plants, Dirt. 
3 0
3 years ago
Read 2 more answers
How do we know that Rupa love the cow ​
Savatey [412]

Kurma Rupa was unique, he claims. He was devoted to the Lord's cattle and, by himself, raised awareness of the issue among a great number of people.

<h3>Kurma Rupa</h3>
  • On June 28th, at the age of 67, Kurma Rupa Das, the director of the cow protection group Care for Cows and a beloved gurukula instructor, passed away in Krishna's sacred city of Vrindavan, India, from metastasized stomach cancer.
  • He was surrounded by Brijabasis singing Krishna kirtan, his beloved cows, and other devotee pals.
  • Kurma Rupa was raised in New York and was born to Mexican parents. He was drafted during the Vietnam War at the age of 21.
  • Kurma Rupa taught youngsters from all over the world for many years at the Bhaktivedanta Swami International Gurukula.
  • He was compassionate and understanding, and he is known for going above and beyond to support the kids in their studies and other pursuits.

To learn more about Kurma Rupa refer:

brainly.com/question/11184843

#SPJ9

3 0
1 year ago
What is the function of fluid compartments in osmosis
natali 33 [55]

Answer:

Total body water can be subdivided into two major compartments, intracellular fluid which is fluid inside cells, and extracellular fluid which is fluid outside of cell like in the blood and in the interstitial tissue between cells.

7 0
2 years ago
Other questions:
  • Unlike amphibians, reptiles
    8·1 answer
  • If height was a complete dominant trait and being tall was represented by ( T ) and being short was represented by ( t ), the mo
    11·1 answer
  • Describe how wavelength , frequency, and energy are related.
    8·1 answer
  • Who was credited with the discovery of the virus?
    12·2 answers
  • Name the level in the hierarchy that describes the smallest unit of life
    13·1 answer
  • Green plants use light from the Sun to drive photosynthesis. Photosynthesis is a chemical reaction in which water and carbon dio
    6·2 answers
  • Components of the innate response include
    5·1 answer
  • What is the product P
    14·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Ano ano ang sangkap sa Ensaladang Talong​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!