All categories

3 years ago

How can a population grow?

Biology

2 answers:

aev [14]3 years ago

8 0

Answer:

The population of the world is continuously growing. This not just causes over-population but reduces employment rates. Not only the population itself was growing, but also the doubling time was decreasing, which basically means that growth itself was growing. This rapid growth increase was mainly caused by a decreasing death rate (more rapidly than birth rate), and particularly an increase in average human age.

HOPE IT HELPS :)

PLEASE MARK IT THE BRAINLIEST!

Vlad1618 [11]3 years ago

6 0

Under ideal conditions, populations can grow exponentially. The growth rate increases as the population gets larger. Most populations do not live under ideal conditions and grow logistically instead. Density-dependent factors slow population growth as population size nears the carrying capacity.

You might be interested in

Which of the following is a community?

lukranit [14]

Answer:

B. All of the fish, bacteria, and mammals that live in a lake

Explanation:

In terms of biology an individual make population, population makes a species and interaction between different species makes community. Interaction of living and non-living things make an ecosystem.

Community involves interaction between all the living organisms present in a given environment. Hence, interaction between fish, bacteria, and mammals that live in a lake is a community.

Hence, the correct answer is "B. All of the fish, bacteria, and mammals that live in a lake".

4 0

3 years ago

Which formed element can be described as membrane-enclosed cytoplasmic fragments?a. monocytesb. erythrocytesc. lymphocytesd. pla

Jlenok [28]

Answer:

d. platelets

Explanation:

Platelets often referred to as thrombocytes, are membrane-bounded cell fragments that are obtained from the dissociation of bigger precursor cells referred to as megakaryocytes, that are produced from stem cells in the bone marrow.

Platelets are necessary for the blood clotting activities, making it very important for wound healing.

7 0

3 years ago

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

5 0

3 years ago

Renewable energy

Kobotan [32]

Answer:

yes it is doing

Explanation:

Renewable sources are those which can use again and again . We should use them to protect our natural resources

4 0

2 years ago

In the analysis, you calculated heart rate averaged over 15 seconds and instantaneous heart rates. explain any differences betwe

Anna007 [38]

<span>The average heart rate is the number of heart beats counted in 15 seconds divided by 15 seconds. The instantaneous heart rate is the time it takes for a single heart beat. Since the heart can beat at varying rates, these values are not necessarily the same.</span>

7 0

4 years ago