1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anygoal [31]
4 years ago
12

Group is

Biology
1 answer:
pshichka [43]4 years ago
4 0

Answer:

1- greater than

2-greater than

3- less than

Explanation:

I just did it on edge

You might be interested in
Effects of caffeine on cognitive functions
Maru [420]
Caffeine works as an adenosine receptor antagonists, this essentially means that it works in the opposite manner or works against the receptor. Think of antagonist in the term of literature it goes against the agonist. Adenosine when bond to the receptor causes tiredness, this is the reason why people drink caffeine to stay wake and to prevent cognitive decline from exhaustion. So caffeine doesn’t really effect learning or memory to a large extent like other stimulants do. So basically caffeine increases wakefulness which in turn allows a person to focus longer, slight increase in memory, and more of a sorted out thought process.
7 0
4 years ago
In eukaryotic cells, the timing of the cell cycle is regulated by
larisa [96]
Regulatory proteins control the cell cycle.

If the regulatory proteins are malfunctioning or absent, the cells may reproduce abnormally fast, causing a tumor.
3 0
4 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
3 years ago
Compare and contrast provirus and retrovirus.
UNO [17]
<span>Provirus - Is is a virus that has attached itself into the DNA of a host cell, while retrovirus is a virus that becomes a provirus. It usually happens when retrovirus invades a cell. According to study while the provirus is attached in to its host, it is not active.</span>
4 0
4 years ago
Do you think a abiotic or biotic factor can be both positive and negative in the same environment?
Charra [1.4K]

Answer: biotic and abiotic factors are the environmental conditions that the organisms have to face to live in a specific environment

Explanation:

3 0
3 years ago
Other questions:
  • Secretion of human chorionic gonadotropin (hcg) occurs during what time frame during pregnancy?
    13·1 answer
  • Which of the following is NOT one of Earth's four spheres?
    11·1 answer
  • Which taste cannot be detected by the tip of the tongue?
    5·2 answers
  • What are two diffrences between replication and transcription?
    13·1 answer
  • PLZ HELP MEH!!!!!! How does RNA act like a messenger to deliver genetic code information?
    8·2 answers
  • A worker standing on a freshly mopped floor is adjusting products on a metal shelf. There is an exposed wire in contact with the
    10·1 answer
  • What is/are one source of sediment along shorelines and on the seafloor?
    13·2 answers
  • Which of the following is a molecule?<br> a)H20<br> b)O2<br> c)CO2<br> d)NaCI<br> e)MhCI2
    10·1 answer
  • 2.
    14·1 answer
  • Scientists define the boundaries between different layers of atomasphere besed on sudden changs in the temperature vs. altitude
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!