Caffeine works as an adenosine receptor antagonists, this essentially means that it works in the opposite manner or works against the receptor. Think of antagonist in the term of literature it goes against the agonist. Adenosine when bond to the receptor causes tiredness, this is the reason why people drink caffeine to stay wake and to prevent cognitive decline from exhaustion. So caffeine doesn’t really effect learning or memory to a large extent like other stimulants do. So basically caffeine increases wakefulness which in turn allows a person to focus longer, slight increase in memory, and more of a sorted out thought process.
Regulatory proteins control the cell cycle.
If the regulatory proteins are malfunctioning or absent, the cells may reproduce abnormally fast, causing a tumor.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
<span>Provirus - Is is a virus that has attached itself into the DNA of a host cell, while retrovirus is a virus that becomes a provirus. It usually happens when retrovirus invades a cell. According to study while the provirus is attached in to its host, it is not active.</span>
Answer: biotic and abiotic factors are the environmental conditions that the organisms have to face to live in a specific environment
Explanation:
