1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yawa3891 [41]
3 years ago
13

Actions that damage people and property may become the responsibility of

Law
1 answer:
Firlakuza [10]3 years ago
4 0

Answer:

If a personal injury was sustained as a result of someone else's negligence then said person and/or entity would be legally liable for the damages caused. Be it to a person or property.

Explanation:

You might be interested in
Amanda and Kelly used to be friends after an argument with Amanda Kelly tell everyone at the galley middle school to me at the n
3241004551 [841]

Answer:

Is this like a legit question

6 0
3 years ago
What do you suppose are strengths of dispute resolution strategies? Select all that apply. When law enforcement and community ad
Dvinal [7]

The strengths of dispute resolution strategies are that dispute resolution rarely results in arrests and is less expensive than adjudication, and focuses on resolving miscommunication and misunderstanding issues.

<h3>What is dispute resolution?</h3>

Dispute resolution is a strategy to resolve differences between two or more groups regarding an issue peacefully and through dialogue.

This method is considered the most appropriate for solving problems because it prevents disputes from ending in violent confrontations and one of those involved being injured or killed. On the contrary, this method ensures that all parties involved get their demands or needs.

According to the above, it can be inferred that as a result of dispute resolution costs can be reduced, number of arrests and it is a way to clarify the message that each one wants to express.

Learn more about communication in: brainly.com/question/22558440

#SPJ1

3 0
2 years ago
Which role does the legislative branch play in making public policy?
MatroZZZ [7]

Answer:

D. Passing a new law about endangered species.

Explanation:

A legislature refers to the legislative body or arm of the federal government that are typically saddled with the responsibility of making or enacting laws. The state legislature is one of the body of governance that has the power or authority to ratify (approve, confirm or give consent) a proposed amendment to the Constitution by getting three-quarter of the states to vote in support.

A bicameral legislature can be defined as a legislative body that comprises of two chambers or houses; the upper house and lower house. The upper chamber or house consists of senators while the lower chamber consists of house of representatives.

Generally, the type of government in which legislators such as senators or house of representative members are found is known as a democracy and they are saddled with the responsibility of enacting or making (passing) new laws.

This ultimately implies that, the role the legislative branch play in making public policy is passing a new law about endangered species. The new law could place a ban on poaching and wildlife hunting while promoting ideas that enhances the conservation of all endangered species, which are going into extinction.

Additionally, a policy can be defined as a conduct or principle of behavior expressed by the government (authority) and are mainly considered to be beneficial and necessary for the growth and development of a person, institution and the society.

8 0
3 years ago
Which of the three cross-cutting core capabilities is described as the establishment and maintenance of a unified and coordinate
quester [9]

Answer:

C. Operational Coordination

Explanation:

Operational coordination can be defined as a cross-cutting core capabilities which typically describes the establishment and maintenance of a unified and coordinated operational structure and process that appropriately integrates all critical stakeholders and supports the execution of core capabilities.

Basically, it is considered to be a core capability which allows recovery partners to network, plan and coordinate with each other in the event of a disaster or when trying to effectively mitigate the risk and effects associated with a disaster.

8 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • Include in your discussion your thoughts on individuals who seem to be lifetime "victims" regardless of the circumstance.
    8·1 answer
  • What is the most accurate description of the criminal justice system?
    12·2 answers
  • Describe the difference between a voluntary and involuntary placement.
    13·2 answers
  • How long is a representative's term of office?
    7·2 answers
  • Rihanna enters into a contract with Britney to provide 100 roses for a dinner party. Britney fails to deliver the roses. Rihanna
    9·2 answers
  • PLS Important, 2 questions
    14·2 answers
  • What is spontaneous desistance​
    7·1 answer
  • The most important law officials in the American colonies were the<br><br>the ANSWER IS sheriff
    11·1 answer
  • Whats the penalty for a school zone violation
    14·2 answers
  • A spouse can be provided information such as hospital
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!