1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tankabanditka [31]
3 years ago
5

In order to support his theory of evolutionary change, Charles Darwin concentrated his studies on the many species of finches in

the Galapagos Islands. Darwin noted that many of the birds had different shapes and styles of beak. What is a possible explanation for what Darwin observed?
Biology
2 answers:
maria [59]3 years ago
5 0

Answer:

A. is the correct answer

artcher [175]3 years ago
5 0

Answer:

A is the answer

Explanation:

its a

You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
The diagram represents the sexual reproduction and development of rabbits. Identify the sexual reproduction process at A .
mafiozo [28]
The process at A is called fertilization.

It is where the gametes of the male and female animal combine.

~~

I hope that helps you out!!

Any more questions, please feel free to ask me and I will gladly help you out!!

~Zoey
5 0
3 years ago
What is germination​
andreev551 [17]

Germination is the process of seeds developing into new plants.

4 0
4 years ago
Read 2 more answers
The strongest muscle contractions are normally achieved by ________. The strongest muscle contractions are normally achieved by
Anna11 [10]

Answer:

Explanation:increasing the stimulation up to the maximal stimulus

5 0
3 years ago
What is the endpoint on the pH scale?
OlgaM077 [116]

Answer:

the endpoint not pH scale is 14

6 0
4 years ago
Read 2 more answers
Other questions:
  • How many feet are in 7,344 inches show work
    7·2 answers
  • Which step of the scientific method relies more heavily on newly collected data than on creativity and innovation?
    8·2 answers
  • In plants what is stroma ?
    14·2 answers
  • I don't even understand this...
    6·1 answer
  • Glucose is broken down to carbon dioxide and water in organisms which breathe air in a process called ________ respiration.
    15·1 answer
  • Which statement is true of enzymes? Choose 1 answer: (Choice A, Checked)
    14·1 answer
  • Arrange the following steps for contraction in the correct sequence.
    13·1 answer
  • Label the stages of infection in the image
    5·1 answer
  • What phenotypes are expected from a cross between a red flower and a white flower snapdragon?
    6·1 answer
  • Compare the nutrition labels of these three options to select the healthiest choice.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!