1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AveGali [126]
3 years ago
5

Help plz for science

Biology
1 answer:
lana [24]3 years ago
5 0
First box is where the Sun's energy is produced.  The second box is hot gases move up and cool gases sink down.  Then Region of the Sun that is visible from Earth. Last is appears as a red ring around the Sun right before and after the peak of a total solar eclipse.  I hope this helps!
You might be interested in
Crystal’s family has noticed that she is always looking up information in books, newspapers, dictionaries, and on the Internet.
Len [333]

Answer:

Self-fulfillment needs

Explanation:

She is achieving her full potential!

8 0
3 years ago
Read 2 more answers
What part of the brain controls body temperature
aniked [119]
The hypothalamus controls body temp
6 0
3 years ago
Read 2 more answers
How does cardiac muscle tissue look like
Nana76 [90]

Answer:

skeletal muscle tissue, striated or striped.

Explanation:

3 0
2 years ago
Read 2 more answers
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Cerebrospinal fluid circulates within the ventricles of the brain and in the subarachnoid space. true or false
lozanna [386]

Answer:

True

Explanation:

CSF is produced by choroid plexus. It starts flowing from the lateral ventricles and move towards the fourth ventricle via the third ventricle. It then moves towards the subarachnoid space which is the region surrounding the brain and spinal cord. From the brain and spinal cord, CSF is absorbed through the blood vessels and passed into the bloodstream again. It then moves to the kidney and liver for filtration.  

Hence, give statement is true

3 0
3 years ago
Other questions:
  • How are AIDS and HIV related?
    9·2 answers
  • The process of splitting water to release hydrogen ions and electrons occurs during the _____ process.
    6·1 answer
  • The main target when controlling the acidity of soils is ______. a. neutralizing the pH b. adding base c. replacing lost cation
    5·2 answers
  • Which of the following is a good reason for why tobacco smoke is considered a carcinogen?
    5·1 answer
  • 5.<br> Which organelle in a plant cell is responsible for the green color of leaves?
    12·2 answers
  • Help me PLEASE! Choose one answer! First one to answer get Brainliest!
    12·2 answers
  • Is the correct order in a homeostatic feedback system stimulus, receoptor, control centre, effector?
    5·1 answer
  • What does it mean to say something “radiates”?<br><br><br>Explain your answer.
    11·2 answers
  • Modeling Photosynthesis
    15·1 answer
  • Through which foramen do axons of motor neurons of the glossopharyngeal nerve pass through?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!