1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanya [424]
3 years ago
9

Which process connects glycolysis and the citric acid cycle?

Biology
1 answer:
Veronika [31]3 years ago
4 0
Keens cycle connects glycolysis and the citric acid cycle.
You might be interested in
Which of the following mechanisms is NOT a way that a carbon atom could enter the atmosphere?
Blababa [14]

Answer:

photosynthesis

Explanation:

8 0
3 years ago
Why is it necessary to classify plants?​
Xelga [282]

Answer:

Plants are classified based on these 3 characteristics: The evergreen plants are plants that retain leaves at all times.

Hope this helps!

6 0
3 years ago
Read 2 more answers
Where do electrons get their energetic in photostem i
RideAnS [48]

Electrons in photosystem I are energized by electromagnetic radiation with a wavelength of about 690 nanometers(colour red). These electrons are received from plastocyanin to then be passed on to NADP to form NADPH+.

6 0
3 years ago
Genetics is defined as: Group of answer choices The scientific study of cells The study of cloning The scientific study of hered
krek1111 [17]

Answer:

The correct answer is ''The scientific study of heredity''

Explanation:

Genetics is a branch of biology that studies how hereditary characters are transmitted from generation to generation and the diversity that exists among living beings. Inheritance is the physical and biological characteristics that we share with our family and that can determine our appearance and our biological characteristics, that is, our phenotype (eye color, skin type, etc.) as well as our internal characteristics. All of this is largely derived from our genetic components, that is, our genotype.

5 0
3 years ago
What are abiotic factors? how do abiotic factors affect organisms in an ecosystem?
ludmilkaskok [199]
Abiotic factors are non living things, such as non living things. A terrain can either help or not help a certain organism.
8 0
3 years ago
Other questions:
  • A cell with 1% solute concentration is placed in a beaker with a 5% solute concentration.
    9·2 answers
  • Give the complementary strand for: ATCGGTA
    8·2 answers
  • Dominance hierarchies
    8·1 answer
  • Parrots also have different types of beaks. Some are long beaks and some are short beaks. Long beaks and
    11·2 answers
  • What is the Function of CAP?
    11·1 answer
  • Why are differences and similarities in DNA and proteins evidence of evolution?
    8·1 answer
  • If. by examining your family history and DNA, you could tell how long you would
    10·1 answer
  • A student records a physical property of a rock as 2.2 N.
    13·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Describe the difference between habitat for a squirrel and its niche
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!