1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gulaghasi [49]
3 years ago
6

Where does iron man come from?

Biology
1 answer:
Dmitry [639]3 years ago
3 0

Answer:

Iron man comes from Marvel Studios. He was created by Stan Lee

You might be interested in
In a laboratory study, antibiotic resistance was shown to arise in populations of lab-grown bacteria in as few as twenty generat
ohaa [14]

Answer:C,D,E

Explanation:I did the USA test prep

5 0
2 years ago
Describe the arrangement of water particles in each state.
Yuri [45]

Answer:

Make sure to attach an image

Explanation:

Click the paperclip and attach an image.

Hope this helps!!!

6 0
3 years ago
What happens when humans burn fossil fuels?
Viktor [21]
Carbon is released into the atmosphere
5 0
3 years ago
Read 2 more answers
The average life span of an erythrocyte in the circulation is
Nataliya [291]

approximately 115 days

Human red blood cells (RBC), after differentiating from erythroblasts in the bone marrow, are released into the blood and survive in the circulation for approximately 115 days.

3 0
2 years ago
From left to right, which is the sequence of the<br> complementary strand of DNA in this molecule?
ladessa [460]

Answer: Option A) A-C-T-T-G

Explanation:

The base sequence on a strand of DNA is usually paired to specific complimentary bases. These specific pairings are as follows:

Adenine (A) pairs with Thymine (T)

Guanine (G) pairs with Cytosine (C). So when you find A replace with T, so also replace C with G and vice versa.

Thus, the complimentary sequence of the T-G-A-A-C DNA strand is A-C-T-T-G

4 0
3 years ago
Other questions:
  • Which glycolytic enzyme(s catalyzes a reaction with an enediolate intermediate?
    5·2 answers
  • Describe phytoplankton
    6·1 answer
  • The human number of chromosomes is 46, so this means:
    7·1 answer
  • A resource that can be replaced by nature at a rate close to which it is used is a:
    6·2 answers
  • The factor being changed by the person doing the experiment in a controlled study is called the
    7·1 answer
  • Explain how bacteria develop resistance to antibiotics
    13·1 answer
  • Woolen garments were produced from _______ raised on the manor.
    11·1 answer
  • When a pregnant woman ingests toxins such as alcohol and
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Is the mass–kinetic energy relationship directly proportional (as one variable increases, the other increases) or inversely prop
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!