1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marishachu [46]
3 years ago
9

I need helppp on thisss !!!

Biology
1 answer:
sergij07 [2.7K]3 years ago
8 0

Answer:

H

Explanation:

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Which is the best approximation of the density a buoy would need to be to test water conditions at a depth of 2000 meters?
DIA [1.3K]

GAnswer:

Explanation:

3 0
3 years ago
What substance ,produce during photosynthesis ,provides food for plants and animals in a food web?
Leto [7]
I think the answer is glucose
6 0
3 years ago
Read 2 more answers
The date/time and amount of an ATM transaction is an example of ____. Analytical information Environmental information Unstructu
Katena32 [7]

Answer:• Transactional data

Explanation: Other examples of transactional data includes purchases, return, invoices, credit, interests, payments, payroll, dividends, contracts etc. Transactional data covers Information documented about exchange, transfer or agreements between individuals/ organization.

7 0
3 years ago
Urine produced in the kidneys is carried to the bladder through a pair of tubes called _____. A. Urethra B. Ureters C. Nephrons
pogonyaev

The correct answer would be B. Ureters

I know this is correct so i hope this helps! :)

7 0
4 years ago
Read 2 more answers
Other questions:
  • When an enzyme lowers the activation of a reaction, what happens?
    12·2 answers
  • Neuronal communication is a two step process. In the second step, which takes place between two neurons, what does the arrival o
    15·1 answer
  • Explain how your body uses ATP and list the three parts of the molecle
    14·1 answer
  • In ancient times, people classified plants and animals using the binomial nomenclature system.
    14·1 answer
  • How are finches in the Galapagos islands a good example of adaptation?
    5·1 answer
  • Match the elements of good experimental design with the examples to the right. different batches of chloroplast Representative k
    13·1 answer
  • Carly has wavy hair. Her father has straight hair, and her mother has curly hair. Which type of inheritance pattern is responsib
    11·2 answers
  • Is this statement true. A an antibody attaches to an antigen to make it harmless
    5·1 answer
  • A certain drug is made from only two ingredients: compound A and compound B. There are
    8·1 answer
  • A hurricane hits a coastal prairie and destroys the habitat. Years later, there is an appearance of small plants with rapidly sp
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!