1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elenna [48]
3 years ago
9

Which two conditions do most seeds need in order to germinate?

Biology
1 answer:
-BARSIC- [3]3 years ago
6 0

Answer:

I believe it is a and c because plants need sunlight and water

Explanation:

You might be interested in
How is a frogs heart different from a fish's?
tankabanditka [31]
The frog heart<span> has 3 chambers: two atria and a single ventricle. The atrium receives deoxygenated blood from the blood vessels (veins) that drain the various organs of the body. The left atrium receives oxygenated blood from the lungs and skin (which also serves as a gas exchange organ in most amphibians).</span>
4 0
3 years ago
Which of these statements about osmosis and active transport is NOT correct?
boyakko [2]
The statement about osmosis and active transport that is not correct is that osmosis requires cell energy while active transport does not. The correct answer is B. 
3 0
4 years ago
Read 2 more answers
Steps followed to solve a problem are called __________. observations prediction methods guessing games scientific methods
stepan [7]
Im pretty sure it is Scientific methods
3 0
3 years ago
Balancing the objectives of sustainable development requires an approach
pashok25 [27]

Answer: Conservation

Explanation:

The sustainable development aims at conservation of natural resources so that these can fullfill the demands of present as well as future generation.

If the resources are not conserved than their concentration will deplete in near future.

7 0
3 years ago
Read 2 more answers
For RNA list the complementary code for G. *<br><br> U<br> T<br> C<br> A<br> X<br> G<br> Y
ElenaW [278]

Answer:

c

Explanation:

this letter no change the only that changes is the letter T in RnA A goes with u That's is the only letter

8 0
3 years ago
Other questions:
  • The concept that living cells only arise from preexisting living cells is called:
    14·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Adrian is a researcher who works in a lab. He decides to perform an experiment to understand the side effects and benefits of dr
    13·1 answer
  • What three cellular structures are found in plant cells but not animal cells?
    9·1 answer
  • What is the correct breakdown and translation of the medical term urethrostenosis?
    10·1 answer
  • A certain species of bacteria, Halobacterium, has a photosynthetic membrne that is colored purple. Its photosynthetic action spe
    12·1 answer
  • A scientist is working on developing refrigerants that do not release chemicals that destroy the ozone layer. this is best descr
    8·1 answer
  • In sedimentary rocks, fossils in lower layers represent fossils that are__________ fossils in the upper rock layer?
    9·1 answer
  • CANN SOMEONE HELP ME PLEASEEE
    11·1 answer
  • It is the sequence of nucleotides in our DNA that makes each one of us unique. Specifically, it is the sequence of nucleotides i
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!