I THINK its (A) im sorry if im wrong i tried reading about it
An omnivore eats both plants and animals!
Badgers, pandas, raccoons, and dogs are examples of omnivores I think!
I believe the answer is the weight of each tomato.
This is because the weight of each tomato depends on the amount of fertilizer (the independent variable/the thing being changed) added to each plant.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer: They do affect the health of an ecosystem.
Explanation: In an ecosystem there are many things that are biotic and abiotic. For an example: water is abiotic and plants/animals are all biotic, the water is not living but it keeps the ecosystem alive by quenching the thirst of the plants growing from the ground and the animals roaming around on the land. Dead animals and plants are not abiotic and they are now providing food for fungi and bacteria. Without the abiotic factors, it would be difficult for the biotic to survive.