1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
FinnZ [79.3K]
3 years ago
6

A variegated leaf with green and yellow patches is used for an experiment to prove that chlorophyll is required for photosynthes

is. Before the experiment the green portions (A), and the yellow portions (B), arte observed. What will be the colour of „A‟ just before and after the starch test? Also write the equation of photosynthesis and mark, well ash molecule the by-product is obtained.
Biology
1 answer:
olga_2 [115]3 years ago
5 0

Answer: The colour of A before the starch test is GREEN while after the starch test is BLUE- BLACK. The equation for photosynthesis is

6CO2 + 6H2O → C6H12O6 + 6O2.

Explanation:

PHOTOSYNTHESIS is the process by which green plants use energy from sunlight to manufacture their own food. It is a building up process since simple inorganic compounds such as carbondioxide and water are built up into large organic compounds such as glucose and OXYGEN is given off as a by product.

Oxygen given out in photosynthesis occurs in the light stage during the process of photolysis of water. This occurs when the chlorophyll traps, absorbs and captures light energy and become energised. The energised chlorophyll supplies energy which is to split molecules of water into hydrogen ion ( H+) and hydroxyl ion ( OH-). The hydroxyl ion is reconverted to water and oxygen is given out as a by product.

To show that chlorophyll is NECESSARY for photosynthesis, a variegated leaf with green and yellow patches is used for an experiment.

The green portion is marked A and the yellow portion marked B. The leaf is tested for starch using the procedure below:

--> place leaf in boiling water for half a minute to kill it.

--> decolorize leaf by placing it in hot alcohol.

--> dip decolorize leaf in hot water to soften it.

--> place leaf on tile and add iodine solution to it.

RESULT: It would be found that only the green parts contain starch as blue+black colouration is observed while yellow area is unaffected by iodine.

You might be interested in
What is meant by evolution through natural selection
VikaD [51]
Hello!

Natural selection is the way that animals evolve. 

The theory of natural selection is that the animals that do not have a specific trait to survive in their environment will die. The animals that do have the trait will survive. The animals that survive will then pass the trait down to their offspring, who will also likely survive because they have the trait. This is how species evolve and continue to survive in their environment. 

The species evolve because only the fittest survive (this is known as "survival of the fittest"). The animals that do not have the needed traits will die and they cannot have offspring. 

I hope this helps answer your question! Have a great day!
4 0
3 years ago
_________ of animals reduces the level of circulating reproductive hormones leading to increased longevity, typically due to red
Lerok [7]
<span>Sterilization of animals reduces the level of circulating reproductive hormones leading to increased longevity, typically due to reduce cancer mortality. The primary aim of animal sterilization is avoiding overpopulation, but this increased longevity could be an added benefit for an individual animal.</span>
8 0
3 years ago
Which of these statements about photosynthesis is correct?
andrew11 [14]
B.

Photosynthesis produces energy which is used during respiration to break down carbohydrates like starch into more usable forms like glucose
4 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
3 years ago
Plants need carbom dioxide in order to survie. plants get this gas from ______, which is something all organisms need
Leviafan [203]

Answer:

Photosynthesis

Explanation:

6 0
3 years ago
Other questions:
  • Sexual reproduction _____. sexual reproduction _____. can produce diverse phenotypes that may enhance survival of a population i
    8·1 answer
  • Because it is difficult to excrete iron once it is in the body, iron balance is maintained primarily through absorption. The iro
    8·1 answer
  • Genes provide a plan for __________________________________, but how that plan unfolds also depends on the _____________________
    14·1 answer
  • Marine debris is best described as being composed of
    15·2 answers
  • According to the medical model, psychological disorders are:A. sicknesses that need to be diagnosed and in most cases cured. B.
    7·1 answer
  • How many calories are in a mg of sodium?? Please help i’m bout to end my life
    7·1 answer
  • Help me please. . . .
    14·1 answer
  • Anne was observing a cell under a microscope which was undergoing binary fission. Which type of cell was Anne observing?
    15·1 answer
  • What is it called when a oceanic and continental crust come together?​
    15·1 answer
  • Which of the following is true about the color of a substance?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!