1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allsm [11]
3 years ago
7

Which of the following best describes Mendel's idea of segregation? A. Each parent has one copy of each gene. Each offspring rec

eives half of its genes from each parent. B. Male offspring receive traits only from the male parent. C. Each parent has two copies of each gene and passes on only one copy to its offspring. D. Female offspring receive traits only from the male parent.
Biology
1 answer:
ikadub [295]3 years ago
8 0

Answer:the answer is C

Explanation:hope it helps

You might be interested in
Which disturbance would result in primary succession ?
NikAS [45]
A disturbance would be things like lava, flows, newly formed sand dunes, or rocks left from a retreating glacier. These are disturbances because Primary Successions happen in lifeless areas, which soil is incapable of sustaining life.
4 0
3 years ago
¿Por qué las células nerviosas no se comportan como las células del corazón?​
vredina [299]

I have no idea what that means but the answer is b

7 0
2 years ago
Igestion of carbohydrates within the small intestine involves enzymes that come from the? a: mouth. b: stomach. c: pancreas. d:
ella [17]

Enzymes come from the pancreas.

What are Enzymes?

Enzymes are proteins that help speed up metabolism, or the chemical reactions in our bodies. They build some substances and break others down. All living things have enzymes. Our bodies naturally produce enzymes.

The small intestine, not the stomach, is where carbohydrates are chemically broken down. The chemical breakdown of digestible carbohydrates is completed by disaccharidases and pancreatic amylase. The circulation carries the monosaccharides to the liver after absorption.

To learn more about pancreatic enzymes click on the link below:

brainly.com/question/15969803

#SPJ4

8 0
1 year ago
A freshwater fish egg that contains 1% solute lives in a freshwater environment that also contains 1% solute. The freshwater sol
djverab [1.8K]

Answer:

It is Isotonic to the fish egg solution

Explanation:

It is Isotonic because Isotonic is a solution that has the same solute concentration with another solution I.e the amount of solute in one solution is the same with the other. This slow the free flow of solutes in equal part through the semipermeable membrane from one solution to the other.

3 0
2 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • Why is algae classified in the Protist Kingdom and not the Plant Kingdom even though they are photosynthetic?
    12·1 answer
  • 1) The length of one day on Earth is determined by how long it takes
    6·1 answer
  • Which of these glands is NOT an exocrine gland?
    15·1 answer
  • How do chemicles cycle and energy flow?
    8·1 answer
  • TRUE or FALSE<br><br> Sandbars are formed through erosion by waves.
    14·1 answer
  • ________ is an inherited condition that affects the heme pathway; it leaves the skin scarred and gums degenerated, and may have
    9·1 answer
  • Cook all raw beef, pork, lamb and veal steaks, chops, and roasts to a minimum internal temperature of _____ as measured with a f
    7·1 answer
  • Gregor Mendel was an Austrian monk who lived in the 1800s. Mendel made many important discoveries related to genetics and heredi
    5·2 answers
  • Classification is done by asking a series of yes or no questions. This questioning method is
    9·1 answer
  • What is the carrying capacity (approx)?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!