1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
TiliK225 [7]
2 years ago
7

Which plant, shown in the cladogram below, shared a recent common ancestor with spikemosses and quilworths?

Biology
1 answer:
MissTica2 years ago
4 0

Answer:

clubmosses

Explanation:

You might be interested in
Which organism develops breathing organs from pharyngeal arches?
KATRIN_1 [288]
I think it’s C
Hope that helped
3 0
2 years ago
With the following crosses of pea plants, give the flower color of offspring and the ratio expected (red is dominant).. . A cros
mixer [17]
<span>The answer is a), all red, as no white alleles are present in the parents, [ and hence cannot be passed on to the offspring. Showing work- Let R represent the dominant (red) allele: RR(male) x RR(female) ----> All RR offspring.</span>
4 0
3 years ago
Read 2 more answers
What is the primary function of the Cell Wall?
Leviafan [203]
To protect and provide support for the cell
3 0
3 years ago
What should you do if you need to leave the laboratory temporarily in the middle of your work?
kondor19780726 [428]

While leaving the laboratory temporarily in the middle of your work remove your lab coat and gloves.

<h3>Laboratory safety:</h3>

Washing your hands is the final thing you should do before leaving the lab after an experiment. Since most chemicals are somewhat harmful, wash your hands before you leave. After taking the necessary measures, inform the teacher.

With its risky processes, hazardous chemicals, and fire threats, the science laboratory is inherently unsafe. Avoid coming into contact with chemicals directly. Never taste, smell, or inhale lab chemicals. After taking off your gloves and before leaving the work area, wash your hands and arms thoroughly with soap and water. In a laboratory, never consume food or liquids, chew gum or tobacco, light up, or use cosmetics. These fundamental safety offer guidance on conduct, cleanliness, and safety to prevent laboratory mishaps.

Learn more about laboratory here:

brainly.com/question/8430576

#SPJ4

8 0
2 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • An object that does not transfer heat easily, such as wood, is called an
    15·1 answer
  • How does convection occur in the troposphere?
    12·2 answers
  • A parasite moving between individuals other than parents and their offspring uses _____ transmission.
    10·1 answer
  • What are mutations?
    12·1 answer
  • medical assistants to ensure the personal and physical safety of stroke and seizure patients during an office visit.
    11·1 answer
  • Describe the function of amino acids
    9·2 answers
  • How would the parasympathetic system help balance the sympathetic system?
    8·1 answer
  • Science helpThank You
    8·1 answer
  • 2. Two common uses of nuclear
    8·1 answer
  • Plant Structure and Function Lab
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!