1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sophie [7]
3 years ago
15

How does water effect an ecosystem?☺️

Biology
1 answer:
Dvinal [7]3 years ago
5 0
Well water is of the most important parts of an ecsystem. If an ecosystem that has a lot of water like the rain forest had a bad drought everything would go wrong. All the plants would die. The animals would have to move somewhere else or they would die so that would cause a major disruption in the ecosystem that they converge or bombard on. 
You might be interested in
What happens in the NEXT stage of mitosis
Gnoma [55]

Answer:

Cytokinesis

Explanation:

Cytokinesis happens after mitosis. It is the final division to create two new cells. In this phase, the cytoplasm divides and two complete daughter cells are created. These two new cells have genetic information that is identical to the parent cell from which they originated.

7 0
3 years ago
Read 2 more answers
What keeps energy moving to surface
Genrish500 [490]
High speeding nuclear particles 
7 0
3 years ago
Read 2 more answers
Ssris alleviate symptoms of depression by increasing the ____.
evablogger [386]

Ssris alleviate symptoms of depression by increasing the<u> ​level of serotonin at the synapse .</u>

Answer: Option C

<u>Explanation:</u>

Ssris (Selective serotonin re-uptake inhibitor) is a drug that is been prescribed to the people with depression and anxiety disorders.  In the brain the information and messages are passed from one nerve cell to the other.  

People with disorders find difficulty in transmitting the information. Hence a drug like SSRI's are prescribed to increase the level of serotonin at the synapse as the nerve cell passes the information through synapse the small gap between the cells.

3 0
3 years ago
Describe the current beliefs on why people age.
Lisa [10]
Programmed Theories - it suggests that our body is designed to age and that there is a timeline that our bodies follow, and switch in our genes that switches off over time.

Error Theories - we age because of environmental hazards that our bodies accumulate over time.
8 0
3 years ago
Photo attached!!!!!!!!!!!!!!
antoniya [11.8K]

Answer:

C, carbon dioxide and water

4 0
3 years ago
Other questions:
  • Match the term with its description. Match Term Definition
    8·1 answer
  • Why are the chemicals in photosynthesis and cellular respiration the same?
    7·1 answer
  • A 50-year-old woman presents with right-sided pleural effusion. Thoracentesis shows the presence of exudative serosanguineous pl
    7·1 answer
  • The amount of time it takes for an amount of a specific isotope to decay to half the original amount.
    5·2 answers
  • Fill in the Punnett square below to visualize the offspring of a cystic fibrosis carrier and a person who doesn't have cystic fi
    8·1 answer
  • Which of the following is an example of an organism maintaining homeostasis?
    7·1 answer
  • Please help me with a biology question!! Thanks
    12·1 answer
  • what is a roan color in cattle is controlled by codominant genes for both red and white hair. if a roan cow is crossed with a wh
    6·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • A mitochondrion has two membranes. The inner membrane is highly folded, as shown in the diagram below.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!