The soon to be male organism, developing from the zygote, receives or inherits the X chromosome from his mother. His father provides him the y chromosome, the smaller of the 2 sex chromosomes.
The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.
This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3' </span><span>the direction (--->)
3' ..</span>aatcg........................ 5' the direction (<---)
adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).
The answer is B. A chemical reaction consists of an endothermic stage (energy taken in to break chemical bonds) followed by an exothermic stage (energy released as bonds are formed). The first stage requires this energy input, which is the activation energy. When the activation energy is reached or exceeded, the reaction will occur. Therefore as soon as this threshold is REACHED, it happens
A subspecies is a taxonomy category that ranks below species, usually permanent geographical isolated race. <span />
Answer:pollen grain
Explanation:
Because it contains male gametophyte.
