1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka2103 [35]
3 years ago
10

The chart shows data collected by ecologist detailing the size of populations prior to and after a limiting factor affected the

population size of a species. Which species were impacted by a density dependent limiting factor? *
A) D only

B) A, B, D

C) C only

D) A, B, C
Biology
1 answer:
katrin2010 [14]3 years ago
8 0

Answer:

d a c b Answers right here

You might be interested in
Answer please!!!
mezya [45]
Dogs, no matter what breed they are, they are all of the same species and therefore can breed with each other and create fertile offspring
 
I pray this helps you :)
6 0
3 years ago
Read 2 more answers
Identify the types of genetic recombination.
ollegr [7]
1.cell membrane
2.Cell startation
3.cell fusion
4.cell reconstruction
5.tissue replacement
6.red blood cells
4 0
3 years ago
I need to know that^?
blondinia [14]

Answer:

ok

Explanation:

6 0
3 years ago
Gene regulation in eukaryotes is regulated by
VLD [36.1K]
<span>repressors as well as by transcriptional activators.</span>
4 0
4 years ago
Which 5 structures does the cell share with prokaryotic bacteria
pav-90 [236]
All cells have a plasma membrane, ribosomes,cytoplasm, and DNA
6 0
3 years ago
Other questions:
  • Beta particles cannot penetrate very far into solids because they _____.
    7·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which two neurotransmitters have roles in appetite suppression?
    8·1 answer
  • An organism must have a ________ in order to be considered living.
    7·1 answer
  • Which of the following statements about sterols is true? A) All sterols share a fused-ring structure with four rings. B) Sterols
    9·1 answer
  • A developer wants to turn part of a local woodlot into a new housing development. A vernal pool exists in the part of the woodlo
    5·1 answer
  • A nurse is teaching a client about self-management techniques for smoking cessation. Which statement made by the client indicate
    7·1 answer
  • Nephrons are part of which of the following structures?
    13·1 answer
  • Are the most likely highly concentrated source of energy in the body
    10·1 answer
  • What is the law of conservation of energy?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!