1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rosijanka [135]
3 years ago
9

What is the equation of a line perpendicular to y=-3/2x+9

Mathematics
1 answer:
Luda [366]3 years ago
8 0

Answer:

g 3 equla mutiply by each other

You might be interested in
Write the slope-intercept form of the equation of each line​
Vera_Pavlovna [14]

First let's talk about the blue line.

You can see its rising so its slope is certainly positive. But by how much is it rising? You can observe that each unit it rises it goes 1 forward and 1 up so its slope is the ratio of 1 up and 1 forward which is just 1.

We have thusly,

y=x+n

Now look at where blue line intercepts y-axis, -1. That is our n.

So the blue line has the equation of,

y=x-1

Next the black lines. The black lines are axes so their equations are a bit different.

First let's deal with x-axis, does it have slope? Yes but it is 0. The x-axis is still, not rising nor falling. Where does x-axis intercept y-axis? At 0. So the equation would be,

y=0x+0=0

Now we have y-axis. Does y axis have a slope? Yes but it is \infty. The y-axis rises infinitely in no run. Where does it intercept y-axis? Everywhere! So what should the equation be? What if we ask where does y-axis intercept x-axis and write its equation in terms of x. Y-axis intercepts x-axis at 0 which means its equation is,

x=0

That is, every point of a form (0,a) lies on y-axis.

Hope this helps :)

8 0
3 years ago
What is the Square root of x
Tanzania [10]

Answer:

x =0

Step-by-step explanation:

Solve for x over the real numbers:

sqrt(x) = 0

Square both sides:

Answer: x = 0

7 0
3 years ago
Read 2 more answers
A fruit company delivers its fruit in two types of boxes: large and small. A delivery of 5 large boxes and 3 small boxes has a t
-BARSIC- [3]

Answer:

The weight of large and small box are 18.25 kg and 13.25 kg respectively.

Step-by-step explanation:

Let the weight of large and small box are x and y respectively.

It is given that a delivery of 5 large boxes and 3 small boxes has a total weight of 131 kilograms.

5x+3y=131                .... (1)

A delivery of 2 large boxes and 6 small boxes has a total weight of 116 kilograms.

2x+6y=116                .... (2)

On solving (1) and (2) using graphing calculator, we get

x=18.25

y=13.25

Therefore the weight of large and small box are 18.25 kg and 13.25 kg respectively.

4 0
3 years ago
Read 2 more answers
In a bag there are blue sweets and red sweets. The ratio of blue sweets to red sweets is 5:3 What fraction of the sweets are blu
levacccp [35]

Answer:

5/8

Step-by-step explanation:

SUM OF RATIOS = 5 + 3 = 8

fraction of blue sweet = blue sweet ratio / sum of ratios = 5/8

4 0
3 years ago
Given r(x) = 11/ (x - 42)
julsineya [31]

For a given function f(x) we define the domain restrictions as values of x that we can not use in our function. Also, for a function f(x) we define the inverse g(x) as a function such that:

g(f(x)) = x = f(g(x))

<u>The restriction is:</u>

x ≠ 4

<u>The inverse is:</u>

y = 4 + \sqrt{\frac{11}{x} }

Here our function is:

f(x) = \frac{11}{(x - 4)^2}

We know that we can not divide by zero, so the only restriction in this function will be the one that makes the denominator equal to zero.

(x - 4)^2 = 0

x - 4 = 0

x = 4

So the only value of x that we need to remove from the domain is x = 4.

To find the inverse we try with the general form:

g(x) = a + \sqrt{\frac{b}{x} }

Evaluating this in our function we get:

g(f(x)) = a + \sqrt{\frac{b}{f(x)} }  = a + \sqrt{\frac{b*(x - 4)^2}{11 }}\\\\g(f(x)) = a + \sqrt{\frac{b}{11 }}*(x - 4)

Remember that the thing above must be equal to x, so we get:

g(f(x)) = a + \sqrt{\frac{b}{11 }}*(x - 4) = x\\\\{\frac{b}{11 }} = 1\\{\frac{b}{11 }}*4 - a = 0

From the two above equations we find:

b = 11

a = 4

Thus the inverse equation is:

y = 4 + \sqrt{\frac{11}{x} }

If you want to learn more, you can read:

brainly.com/question/10300045

3 0
2 years ago
Other questions:
  • Which digit is in the ones place?
    7·2 answers
  • In △ABC,a=13, b=14, and c=18. Find m∠A.
    14·2 answers
  • You are buying boxes of cookies at a bakery. Each box of cookies costs 4$. In the equation below, c represents the number of box
    10·1 answer
  • Using the Law of sines, in triangle ABC, if measurement of angle B = 105°, b = 23, a = 14, find measurement of angle A
    13·1 answer
  • Which equation represents the line that passes through points (1 -5) and (3 -17)
    13·1 answer
  • There are 876 students in a school. There are 46 more boys than girls. How<br> many boys are there?
    13·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Find the new amount given the original amount and the percent of change. $35,000; 7% decrease​
    8·1 answer
  • Daniels mom gave him $8 for his allowance He wants to buy new shoelaces for his vans that cost $5. What percentage of his money
    6·1 answer
  • I need help!! please, you don’t even have to do it all just explain to me how to do the first one I’ll catch on
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!