1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tasya [4]
4 years ago
7

Light acts like a____ when it bounces off surfaces, and acts like a_____when it bends around objects.

Biology
2 answers:
VARVARA [1.3K]4 years ago
7 0
<h3><u>Answer;</u></h3>

-Particle

-Wave

Light acts like a <u>particle</u> when it bounces off surfaces, and acts like a <u>wave </u>when it bends around objects.

<h3><u>Explanation</u>;</h3>
  • Reflection is a phenomenon that occurs when waves bounces back from a surface or a boundary they cannot pass through.
  • <em><u>Light behaves like a wave and also as a particle.</u></em>
  • <em><u>Light acts like  particles or little light bullets that stream from the source which is how shadows work. </u></em>
  • <em><u>The ability of light to move around bends objects, or undergo diffraction and interference, shows that light acts as a wave.</u></em>
mafiozo [28]4 years ago
3 0
Light acts like a particle when it bounces off the surface, and acts like a wave when it bends around objects.
You might be interested in
During a total lunar eclipse what happens
leonid [27]

Answer:

B

Explanation:

The moon moves in the earth's shadow and is blocked by the earth .

4 0
3 years ago
Read 2 more answers
25 POINTS!! Survival of the Fittest is due to having the possession of what?
Mariulka [41]

Survival of the Fittest is due to having possession of Adaptations (Option 1).

<h3>What is an adaptation?</h3>

An adaptation is a type of feature/trait in an organism that confers an advantage against other organisms in an environment.

Adaptations are fundamental to face challenging environmental conditions for different organisms.

The main evolutionary force by which different adaptations are favored in nature is natural selection.

Learn more about adaptations here:

brainly.com/question/29594

3 0
2 years ago
describe how our darkens in the presence of sun. in your description, be sure to name the pigment that darkens our skin and desc
Aleonysh [2.5K]
Special cells in the skin<span>, called melanocytes, make two different types of melanin, eumelanin and pheomelanin. ... Melanin helps </span>protect our skin<span> and hair by filtering out potentially harmful ultraviolet (UV) radiation from the </span>sun. The UV light from thesun<span> can </span>damage DNA<span> and cause cancer</span>
5 0
3 years ago
What scientist designed an experiment that enabled the first successful detection of an individual subatomic particle?
kirill [66]
The correct answer for this question is this one: "c. J.J. Thompson." J. J. Thomson is the <span>scientist who designed an experiment that enabled the first successful detection of an individual subatomic particle. </span>J.J. Thomson<span> (Sir Joseph John Thomson, 1856-1940), who demonstrated in 1897 that "cathode rays" consisted of negatively-charged particles, later named electrons.</span>

3 0
3 years ago
All of the following are characteristics of the genetic code EXCEPT
aev [14]
The answer is A) it is stored only in the nucleus of all living cells<span>

The genetic code is the set of rules that explains how the information is transferred from DNA to the proteins. It is made of the </span>same components in all living organisms and is found in the base sequence of the nucleic acids. Also, it <span>is read only in groups of three nitrogenous bases. But it is not stored only in the nucleus of the cells. DNA material is present in mitochondria as well. Nevertheless, in Prokaryotes, there is no nucleus, so the genetic information is in the cytoplasm.</span>
4 0
4 years ago
Other questions:
  • To construct a mapping cross of linked genes, it is important that the genotypes of some of the gametes produced by the heterozy
    12·1 answer
  • Q 15.19: Cell bodies of preganglionic neurons of the parasympathetic division are located in which of the following cranial nerv
    10·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • By what reproductive mechanism does a haploid animal grow?
    15·2 answers
  • Manufactured compounds called _____________________________________ , that were being released into the atmosphere from products
    5·1 answer
  • All other organisms in a community are consumers, also called:
    6·1 answer
  • Help pls!! quick!! pls!! thank you!!
    5·1 answer
  • Molly's cut is bleeding and she is worried that it will not stop. Using your knowledge of the homeostatic process, what would yo
    15·1 answer
  • which of the following hormones produced in the anterior pituitary stimulates the production of progesterone and estrogen by ova
    7·1 answer
  • Write a claim indicating which type of beak has an adaptive advantage in Geospiza fortis during a drought. Next, provide evidenc
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!