A divide is the elevated boundary between areas that are drained by different rivers system
        
                    
             
        
        
        
Answer:
The given statement is false.
A neuron is the basic structural and functional unit of the nervous system. It helps in transmitting information from one neuron to another neuron, gland, or muscle cell.
The conduction of nerve impulse is electrochemical in nature. It transmits the impulse electrically through the axon the nerve cells and chemically through synapses (gap between two nerves cells).
The axon terminals of pre-synaptic nerve cell release chemical messengers (also called neurotransmitters) in the synaptic cleft. These messengers then bind to the receptors present on the post-synaptic nerve cell and regenerate the nerve impulse.
 
        
                    
             
        
        
        
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA. 
In mRNA 
A - U 
G - C 
T - thymine is absent and is replaced with U - uracil in mRNA. 
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following : 
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG. 
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand. 
        
             
        
        
        
What happens to the ocean water as it moves from Antarctica to the equator is : ( B )  It becomes less dense and rises to the surface.
<h3>Concept conveyor belt </h3>
The conveyor belt is a system of oceans which transports water and propel deep current of water bodies across the globe based on the differences in water densities. 
As the ocean water moves from the Antarctica to the equator the cold ocean water mixes with the warm ocean water at the equator, which makes the water less dense and rises to the surface. 
Hence we can conclude that What happens to the ocean water as it moves from Antarctica to the equator is  It becomes less dense and rises to the surface.
Learn more about the conveyor belt : brainly.com/question/14910379
#SPJ1