1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
3 years ago
13

When writing the name of an organism which part starts with a capitol letter?

Biology
2 answers:
Anna11 [10]3 years ago
4 0
The answer is B. Genus
Pani-rosa [81]3 years ago
3 0

Answer:

I believe it is Genus, but I'm not sure.

Explanation:

You might be interested in
A divide as it relates to earth science is the
gulaghasi [49]
A divide is the elevated boundary between areas that are drained by different rivers system
3 0
3 years ago
Read 2 more answers
A neuron transmits information by the secretion of hormones. True or False
grandymaker [24]

Answer:

The given statement is false.

A neuron is the basic structural and functional unit of the nervous system. It helps in transmitting information from one neuron to another neuron, gland, or muscle cell.

The conduction of nerve impulse is electrochemical in nature. It transmits the impulse electrically through the axon the nerve cells and chemically through synapses (gap between two nerves cells).

The axon terminals of pre-synaptic nerve cell release chemical messengers (also called neurotransmitters) in the synaptic cleft. These messengers then bind to the receptors present on the post-synaptic nerve cell and regenerate the nerve impulse.

4 0
3 years ago
Read 2 more answers
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
Based on the concept of the global conveyor belt, what happens to ocean water as it moves from Antarctica to the equator?
marta [7]

What happens to the ocean water as it moves from Antarctica to the equator is : ( B ) It becomes less dense and rises to the surface.

<h3>Concept conveyor belt </h3>

The conveyor belt is a system of oceans which transports water and propel deep current of water bodies across the globe based on the differences in water densities.

As the ocean water moves from the Antarctica to the equator the cold ocean water mixes with the warm ocean water at the equator, which makes the water less dense and rises to the surface.

Hence we can conclude that What happens to the ocean water as it moves from Antarctica to the equator is  It becomes less dense and rises to the surface.

Learn more about the conveyor belt : brainly.com/question/14910379

#SPJ1

8 0
2 years ago
The temperature scale used most widely by scientists around the world is the _____ scale.
Usimov [2.4K]

celsius it’s used all over

6 0
3 years ago
Read 2 more answers
Other questions:
  • Boat A and Boat B have the same mass. Boat A’s velocity is three times greater than that of Boat B. Compared to the kinetic ener
    9·2 answers
  • How can someone prepare for losing sight?
    12·1 answer
  • Why is information that has been peer edited more reliable than information that has
    9·1 answer
  • During high intensity exercise, lactate can be converted to which substance via the cori cycle?
    10·1 answer
  • What would most likely occur during the formation of rocks.
    5·1 answer
  • How many species of hominin coexisted 100,000 years ago?
    10·1 answer
  • . . The study of animals' structures, behaviors, functions, and evolution is called _____Select one from the choices given: etho
    6·1 answer
  • The lymph nodes in your neck may become swollen when you have a bacterial infection in your throat as a result of:
    12·1 answer
  • Question 8 (1 point)
    15·1 answer
  • Explain the process by which the modern Northeast (Maryland) coyote population changed from the historic (North Dakota) populati
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!