1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sladkih [1.3K]
3 years ago
11

Which pair is NOT related? cells and tissue nucleus and DNA cell wall and plants chloroplast and animals

Biology
1 answer:
Yuri [45]3 years ago
3 0
"chloroplast and animals" are not a match, since chloroplast only exists in plants and smalls cells for the purpose of utilizing photosynthesis. Animals do not require this process.
You might be interested in
Which of the following conditions best match this graph? A graph with Years on the x-axis from 0 to 6 and Rabbits on the y-axis
KIM [24]

sitsyidiyxiydgksutsjgxjtdjgstizjgstisitstustisitsuteyoditsjtsi5shreitsitsjf

5 0
3 years ago
Read 2 more answers
Marisol is sitting in a bus that is passing by a traffic light which statement correctly describes Marisol's motion
boyakko [2]
The answer is She is moving to the traffic light, but she is not moving relative to the bus driver.


Hope I helped
3 0
3 years ago
The size of a frog population in a pond remains fairly constant over a period of several years because of a. decreasing competit
Fittoniya [83]

Answer:

d

Explanation:

6 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Which statement best describes an environmental consequence of unsealed landfills? Landfills can produce carbon dioxide that lea
kirill [66]

The correct statement describing environmental consequence of unsealed Landfills is : ( A ) Landfills can produce carbon dioxide that leak into the atmosphere

A landfill is composed of 4 essential components and some are ;

  • bottom linear
  • hydrogeologic component and
  • A cover ( seal )

Given that a landfill constitutes of about 40 to 60 percent of C0₂ the environmental consequence of not providing a proper seal for the landfill will be the leakage of C0₂ into the atmosphere. while

The release of Heavy metals as leach ate into the surrounding can be controlled with the provision of a system in the landfill, materials in landfill undergo decomposition for a long period of time.

Hence we can conclude that Landfills can produce carbon dioxide that leak into the atmosphere.

Learn more : brainly.com/question/12745559

5 0
3 years ago
Read 2 more answers
Other questions:
  • I Need Help With Number 7 8 9 & 10
    6·1 answer
  • In music, when we see the word "cycle," it indicates
    10·1 answer
  • A scientist isolates a gene from a human cell that codes for a specific protein. The gene is inserted into a bacterial plasmid i
    8·2 answers
  • The area is the brain the controls, temperature, metabolism and water/electrolyte balance is called?
    11·2 answers
  • Bleh can you help? ill give brainleist to best awnser :3 (if i can)
    11·1 answer
  • Dog gametes contain 33 chromosomes. What is the genetic content of a dog body cell?
    11·1 answer
  • In at least five (5) sentences summarize how humans are changing the carbon cycle?
    12·1 answer
  • ⁉️‼️NEED answer ASAP‼️⁉️The pH of a solution is 7. Which best describes a solution? Solution has more hydrogen ions and hydroxi
    7·2 answers
  • Choose all the right answers. Which items are common features of most mammals? produce milk come in all sizes fertilized egg dev
    9·2 answers
  • Environmental factors typically activate genes in a cell by causing the cell to --
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!