Answer:
a. Oligosaccharides and polysaccharides are classified as simple carbohydrates.
b. Carbohydrates contain carbon, hydrogen, and nitrogen.
c. Sucrose is composed of one glucose molecule and one maltose molecule.
d. Lactose is a five-carbon monosaccharide found in ribonucleic acid (RNA).
e. Glucose, fructose, and galactose each contain 6 carbon atoms, 12 hydrogen atoms, and 6 oxygen atoms.
Click again to see term
Explanation:
:(
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Answer:
Yes, It is theoretically possible seeing that one or both of them have the gene for white eyes.
Explanation:
In these species, the populations fluctuate by having spikes due to the surface temperatures that increase as a consequence of global warming. It is a consequence of global warming in natural populations.
<h3>Global warming</h3>
Global warming refers to the constant increase in temperatures on Earth's surface due to human activities.
The human activities that lead to global warming include deforestation, burning fossil fuels, and farming livestock.
Global warming affects warm water species by the increase in water temperatures, thereby affecting also water quantity and water quality.
Learn more about global warming here:
brainly.com/question/3553382
