1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sophie [7]
3 years ago
10

After letting his soil sample sit in water for an hour, Mark concludes that just one type of material made up the soil. Jack con

cludes that the soil had several different materials, each with a different weight. Based on the results of your experiment, whose conclusion do you support and why?
Biology
2 answers:
Mumz [18]3 years ago
5 0

Answer:

Jack i right

Explanation:

it seems awfully strange if only one type of material makes up the whole soil.. obviously the soil will consist of more than one. most soil is made up of minerals, rocks and organic matter , remember that they have several particles within them with different measurements.

shusha [124]3 years ago
4 0

Answer:

jack is right

Explanation:

most soil is made up of minerals, rocks and organic matter , remember that they have several particles within them with different measurements.

You might be interested in
What is the long term and short term goal of every organism?
levacccp [35]
Long term is to mate. I don't know about short term
5 0
3 years ago
As a research scientist, you measure the amount of ATP and NADPH used by the Calvin cycle in 3 hours. You find 9,000 molecules o
Vadim26 [7]

Answer:

The correct answer is - Cyclic flow.

Explanation:

Cyclic electrons flow pumps proton in the lumen of thylakoid towards the concentration with the help of ATP synthase. This movement produces additional ATP.

These additional ATPs are come from cyclic electron flow, during light reaction come from cyclic electron flow, during light reaction.

6 0
3 years ago
Why do you think it’s important for scientists to study Earth’s past climates? What information are scientists likely to gain fr
Sonbull [250]

Answer:

They are able to obtain information on how the climate used to be so that they can help us better prepare for the climate we may face in the future. At times, however, paleontologists findings cannot be trusted because some things would be too hard to find. 

Explanation:

3 0
3 years ago
The Products (molecules on the right side of a chemical equation) of Aerobic Cellular Respiration are __________.
NISA [10]

Answer:

The products of aerobic cellular respiration are <u>CO2</u>, <u>H20 (Water Vapour)</u>, and <u>Energy</u>.

C6H1206 + O2 ➔ CO2 + H20 + Energy

Glucose + Oxygen ➔ Carbon Dioxide + Water Vapour + Energy

6 0
2 years ago
The environmental benefits of composting include all of following EXCEPT____________.
andriy [413]

Answer:

B. generation of rich organic fertilizer.

Explanation:

Compost and fertilizers are different. There is a simple way to distinguish between compost and fertilizers.  Compost feeds the soil, and fertilizer feeds the plants. Fertilizer adds to the soil for nutrient supplying purpose to the plants. But compost helps to increase the microbial activities of the soil, which improves the health of the soil.

6 0
3 years ago
Other questions:
  • The earth has 3 main chemical layers: a core, mantle, and crust these layers formed from a process called ________ during planet
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • When plants grow towards sunlight, they ____?
    8·2 answers
  • What are cells where the genetic material is contained in membrane-bound nuclei?
    8·1 answer
  • Which is the fastest growing plant on earth?​
    15·1 answer
  • A particular hormone travels by many types of cells in the body. Which mechanism ensures that it acts only on the target cells?
    14·1 answer
  • Why can inbreeding be potentially harmful to populations?
    12·1 answer
  • Which diagram represents binary fission?
    10·1 answer
  • What is respiration​
    13·2 answers
  • What is the total magnification with each objective?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!