1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scrat [10]
2 years ago
9

Replanting trees on a bare hillside is an example of

Biology
1 answer:
Pachacha [2.7K]2 years ago
5 0

Answer:

A

Explanation:

firstly, conservation because by planting trees, the land dat was once proned to erosion is covered thereby conserving de land and reforestation because, u hv replaced trees dat were once cut there

You might be interested in
Atomic symbol for carbohydrate?
Doss [256]
The structure of a carbohydrate(sugars) is Carbon, Hydrogen, and Oxygen.
6 0
3 years ago
Which of the following transport mechanisms utilizes energy? A) osmosis B) Diffusion Facilitated difusion D) endocytosis
prisoha [69]
D) Endocytosis is a transport mechanism that utilizes energy.
Endocytosis is an active transport, a biological process in which <span>molecules from outside the cell (proteins for example) are passed through the cell membrane and put into the cell. This process requires energy.

The other transport mechanisms, osmosis, diffusion and facilitated diffusion are processes that do not utilize energy. </span>
4 0
3 years ago
Read 2 more answers
What is the proper way to carry a microscope
Readme [11.4K]
Usually by the neck or the metal piece of where you put your eye.
3 0
3 years ago
Read 2 more answers
Which is an abiotic factor that can be found in a rain forest ecosystem?
777dan777 [17]
Correct answer: B. oxygen
3 0
3 years ago
Most bacteria are
MissTica
The answer B - unicellular prokaryotes
6 0
3 years ago
Other questions:
  • Behaviors such as stress, exercise, eating patterns, and tension ______ various aspects of the hormonal system.
    6·1 answer
  • The outer periphery of the intervertebral disk is composed of strong fibrous tissue called the:
    15·1 answer
  • Why the constitution important <br>​
    6·1 answer
  • 5. A gene has a base sequence of GTC. Due to a mutation, the base sequence changes to GTG. Answer the following questions using
    10·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What was the variable in Pasteur's experiment?
    7·2 answers
  • which of the following statement is true about the nutrient cycle? A. plants fix nitrate into atmospheric nitrogen. B. all the n
    8·1 answer
  • ¿Cuál es el hidrato de carbono que aporta energía en la primera instancia?
    6·1 answer
  • What is exine is made up of????
    9·1 answer
  • What are two contributing factors to evolution?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!