1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
levacccp [35]
3 years ago
14

In humans, hemophilia is sex linked. If a woman is a carrier for the trait, what is the chance that her daughters will also be c

arriers? (Assume their father is normal.)
Biology
1 answer:
frez [133]3 years ago
8 0
There is a 50% chance the daughters will be carriers of the trait.

The little x on the diagram I drew represents the trait.

You might be interested in
Why is'nt milk converted into curd by adding buttermilk while the same is possible with curd?
ankoles [38]
Two different types of milk
6 0
3 years ago
Which of the samples shown below are photosynthetic
Advocard [28]

Answer:

A, C and D are photosynthetic. They are green stained suggesting the presence of chloroplast and has multiple mitochondria for energy production

6 0
3 years ago
What is the answer for B? ​
SCORPION-xisa [38]

Answer:

wheres b?

Explanation:

4 0
3 years ago
How does the skeletal system work with the muscular system
erik [133]

Answer:

Muscles connect to your skeleton and they contract and move the skeleton along.

Explanation:

Your skeletal system is made up of cartilage and calcified bone that work together. They help the process of movement happen in a smoother manner. The calcified bones of your skeleton also work with the circulatory system.

7 0
4 years ago
Which would be most effective in reducing indoor air pollution in an environment high in volatile organics (VOCs)? A) cover the
Lunna [17]
The correction option is VENTILATE THE AREA.
In order to reduce indoor air pollution, the best thing to do is to ventilate the area. Ventilation involves provision of fresh air into a room in order to flush out and eliminate indoor pollution.
5 0
3 years ago
Other questions:
  • An individual's ability to remember the day he or she first swan the length of a swimming pool is most clearly an example of ___
    5·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Why is it important that our understanding of social science concepts continue to develop and expand?
    9·1 answer
  • The ecological relationship between largemouth bass and whirligig beetles is best described as:
    7·1 answer
  • Can Adaptations can be detrimental to the survival of a species.
    15·1 answer
  • Identify the parts of the sun labeled A,B,C,D, and E
    5·1 answer
  • Which factor may help begin an ice age? Select all that apply
    10·1 answer
  • In specialized transduction the bacterial genes transduced tend to be: Select one: a. those genes in greatest use by the bacteri
    13·1 answer
  • GIVING BRAINLIEST!!!
    11·2 answers
  • All you need is in the photo ​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!