1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
uysha [10]
2 years ago
15

What is phylogeny?

Biology
2 answers:
ollegr [7]2 years ago
7 0

Answer:

C. How organisms are related through evolution.

Explanation:

Phylogeny is the organisms that are related through evolution.

ExtremeBDS [4]2 years ago
4 0

Answer:

Hey mate......

Explanation:

This is ur answer......

<h2>C. How organisms are related through evolution...</h2>

Hope it helps!

Brainliest pls!

Follow me! :)

You might be interested in
Which sentence best describes a cell that is isotonic for a substance?
ZanzabumX [31]
The answer would be C) The solute concentration is equal on both sides of the cell membrane.
This is correct because in an isotonic solution, they would have the exact salt concentration as the blood surrounding the cell. There won't be an effect on the surrounding cells. So, the cells won't gain or loose any water. 
Hope this helps!:)

4 0
2 years ago
Read 2 more answers
Diffusion is the movement of particles against the concentration gradient
lys-0071 [83]

Answer:

incorrect

Explanation:

diffusion is the movement of particles <u>with</u> the concentration gradient

for example: over time, food coloring and water mix and become one same color.

3 0
2 years ago
Read the sentence from the introduction [paragraphs 1-2].
mojhsa [17]

Answer:

(C) damaging I think but not sure

7 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Twind is considered to be an abiotic factor because it.?
stepladder [879]
Wind is considered an abiotic factor because it is not a living organism.

Hope this helps!
8 0
3 years ago
Other questions:
  • Which of the following balances is affected by the local force of gravity? A) Beam Balance B) Analytical Balance C) Spring Balan
    10·1 answer
  • You are asked to draw blood from the median cubital vein. you will search for this vein in the ________.
    12·1 answer
  • Anaerobic respiration produces a maximum of ______ ATP per glucose.
    11·1 answer
  • Question 34 (5 points)
    10·1 answer
  • Which type of blood vessel usually carries oxygen-poor blood?
    15·2 answers
  • That picture came out horrible lol sorry but can I get some help
    10·1 answer
  • In what ways might particle in the waste matter one organism be useful to another organism? give 2 or 3 examples to support your
    9·1 answer
  • The change in weather is what causes the change in seasons?
    7·2 answers
  • Explain the process of the Greenhouse Effect. How does it happen?
    15·2 answers
  • What was the earliest prehistoric culture to have lived in oklahoma.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!