1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vaieri [72.5K]
3 years ago
14

When determining if a pig is

Biology
1 answer:
zmey [24]3 years ago
6 0
The answer would be A
You might be interested in
Viruses have a domain specific to them - true or false?
marshall27 [118]
There are three large domains: Bacteria, Archaea, and <span>Eukarya. Therefore, the </span>answer is FALSE viruses do not have a domain.
4 0
3 years ago
Read 2 more answers
Explain the process of transcription
Klio2033 [76]
Transcription is the process in which mRNA is produced from DNA by using transcriptase enzyme.it involves the following process:splicing,5 END methylation cup,3 end polytail A .
5 0
4 years ago
Read 2 more answers
In which biome would you be most likely to enjoy leaves changing color in the fall?
Marina CMI [18]
Temperate forest biome.
3 0
4 years ago
CAN SOMEONE PLEASE HELP!!!!!!!!!!
kkurt [141]

Answer:

A series if reaction break and rrarrange csrbon bonds to release energy ang carbon dioxide.

6 0
3 years ago
Pls help me with this
Pachacha [2.7K]

Answer:

Sexual reproduction.

Explanation:

Like most mammals, giraffes produce sexually, meaning that both parents contribute to the DNA of the offspring.

3 0
3 years ago
Other questions:
  • Skin surfaces that lack hair contain specialized epithelial cells called which are sensitive to touch
    8·1 answer
  • The _____ are pure forms of matter that cannot be broken down into simplier substances.
    8·1 answer
  • Describe generally what happened to each spot of each type of ink. which had the most pigments?
    13·1 answer
  • What is a group of ravens called?
    14·1 answer
  • In which direction is the Pacific Plate moving in relation to the North American Plate?
    14·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Which type of rock does magma form when it hardens?
    7·1 answer
  • What is the name of the darker blue/purple section that is cut out of the magenta molecule?
    9·1 answer
  • El desarrollo de la teoría celular se debe básicamente de
    11·1 answer
  • Which fact supports the following conclusion?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!