1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ElenaW [278]
3 years ago
6

Fill in the missing numbers to complete the pattern: 2.83, 3.23, 3.43, 3.63

Mathematics
1 answer:
serg [7]3 years ago
8 0

Answer:

2.63 , 2.83 , 3.03 , 3.23 and ...

Step-by-step explanation:

every step 0.20 is added to previous step

You might be interested in
PLEASE HELP, URGENT!!
EastWind [94]

Answer:

I don't get it

Step-by-step explanation:

7 0
3 years ago
Hepl me what is the answer to this math question
Luda [366]

Answer:

c

Step-by-step explanation:

6 0
3 years ago
A plumber is fitting A water pipe that is 3/4 foot long on to a water pipe that is 2/12 foot long.How long will the finish pipe
viktelen [127]
Add 3/4 foot to 2/12 foot.  The LCD here is 12.

Thus, add 9/12 foot to 2/12 foot.  Answer:  11/12 foot.
 
 Are you sure you copied down that "2/12" correctly?  Note that 2/12 = 1/6 
3 0
2 years ago
Read 2 more answers
The next train will arrive in 32 minutes and 30 seconds. In how many seconds will the next train arrive
sineoko [7]
You need to multiply the 30 with the 32
4 0
3 years ago
Read 2 more answers
This question is worth 4 points: what does the p in the example below mean? (p < .05) the finding has a 95% chance of being t
Art [367]
I think that it is (0<0.5)
6 0
3 years ago
Other questions:
  • Hi the mean of the following data $ 11,
    12·1 answer
  • PLEASE HELP ASAP! I WILL GIVE BRAINLIEST!
    5·2 answers
  • What is an algebraic expression for 'two thirds of a number (d) to the third power' ?
    10·2 answers
  • The sales tax on a piece of furniture that cost $450 was $28.13.What was the percent sales tax.
    10·1 answer
  • If red oak lumber weighs 63 pounds per cubic foot, how much does one cord of red oak weigh? (A cord is a measurement for bulk wo
    7·1 answer
  • If Mike uses a 3 to 1 ratio of beef to pork how much pork will he use with a total of 3 pounds?
    5·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • - 27 - 13c=9<br><br><br> would this come out to be a fraction?
    12·1 answer
  • Plz help!<br> solve for t
    5·2 answers
  • Please help meeeeeeeeeeeeeee
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!