Answer:
Immediately, the pathogen has been recognized:
Macrophages acts as the first line of defence by engulfing pathogens identified by antigens which will now present the antibody shape to a helper T cell.
The Helper T cells produce a signal to plasma and Memory B cells to yield antibodies that attach to the antigens. The cytotoxic cells that leads to cell death are activated by the helper T cells.
Antibodies helps to immobilize pathogen for macrophage to feed on.
if the pathogen comes back a 2nd time the memory cells helps in quick and efficient recovery by producing the specific B and T cells for the antigen.
DNA replication occurs in interphase, producing two sister chromatids
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
By the amount of silica
cause igneous rock is classified by their color, texture and chemical composition
