The food chain works like, us humans are at the top we eat everything below and because we are at the to of the food chain nothing eats us and everything below gets eaten. OK think about it like this the small fish eats the plankton and the medium fish eats the small fish and so on the big fish eats the medium fish and then the human or shark eats the big fish
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
The Circulatory System
Explanation:
When blood is rich in carbon dioxide it leaves the heart through the pulmonic valve, into the pulmonary artery and to the lungs. (All of which have to do with the circulatory system)
