1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
crimeas [40]
3 years ago
10

In some parts of the Edwards Plateau ecoregion in Texas, overgrazing from deer and livestock is killing the grasses that live th

ere. How will the the soil in these areas likely be impacted by overgrazing?
A.
Precipitation will soak into the soil more easily.
B.
Deposition will create more soil.
C.
Weathering will make the soil less useful.
D.
Erosion will remove more of the soil.
Biology
1 answer:
svlad2 [7]3 years ago
8 0
C because of the animals stomping all over
You might be interested in
The section of the cell membrane illustrates one method of cellular transport. Consider steps A, B and C. What transport mechani
andrezito [222]
The model attached represents facilitated transport, which is answer choice D. In the model, there are protein channels, which allow molecules to pass through them if they're too large to fit through the aquaporins (making diffusion an incorrect answer.) We can eliminate active transport since ATP isn't used to control transport, and we can eliminate endocytosis as it is a form of active transport. The remaining answer would be facilitated transport, which is a form of passive transport. Hope this helps! :)
3 0
3 years ago
Improve the student’s model of gas exchange by drawing the missing component.
larisa [96]

Answer:

The diagram can be improved by:

                                  Lungs

                                       ↓

                                   oxygen

                                       ↓

                      Red blood cells (carrying oxygen)

                                       ↓

                  Organs (like stomach and liver etc) from where carbon    

                               is taken and oxygen is supplied

                                         ↓

                   RBC's carrying Carbon dioxide to the lungs

The component which is missing in the diagram are the organs where exchange of gases occurs. The red blood cells carry oxygenated blood from the lungs to all parts of the body and carries the wast carbon dioxide gas from them back to the lungs. The carbon dioxide is then exhaled by the lungs.

8 0
3 years ago
Read 2 more answers
Which of the following terms relate to the meaning of "physical"?
nikitadnepr [17]

Answer:

the answer is body

Explanation:

because physical is something you can touch you cant touch any of the other terms with your fingers except bodys so that's the answer

3 0
3 years ago
Read 2 more answers
Which of the following describes how the endocrine system could cause blood pressure to decrease?
guajiro [1.7K]
I think the answer would be D
5 0
3 years ago
Read 2 more answers
Over time, what will happen to the population of brown mice that live in a
Sunny_sXe [5.5K]

Answer:

The population will decrease

Explanation:

The reason it will decrease is that the predators will be able to find the brown mice more easily in the snow then the white mice.

7 0
3 years ago
Other questions:
  • Why is it that RNA can catalyze reactions but DNA cannot?
    7·1 answer
  • Which of the following statements are false?
    15·1 answer
  • Which is a function of the cardiovascular system?
    13·1 answer
  • What are possible causes of extinction .????
    9·1 answer
  • Keystone species affect the populations of many other species in a community.<br> True<br> False
    5·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • The specialization of the pharyngeal jaws of cichlids for different diets represents a trade-off in function because ___________
    5·1 answer
  • ¿ Cuales acciones de limpieza deben realizarse en casa, para mantener un ambiente sano en su interior y entre quienes la habitan
    11·1 answer
  • Wind moves from areas of ??pressure to ??
    12·2 answers
  • 2. Choose all of the answers that apply to catabolic metabolism (Check all that apply)
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!