The type of mutation seen is germline mutation
Answer:
This is known as incomplete dominance
Explanation:
The phenotype of a heterozygous organism can actually be a combination between the phenotypes of its homozygous parents.The heterozygous offspring and the incomplete dominance of the purple trait are a phenotypic intermediate between the parents
1 - A ground level plant develops curling tendrils that wrap around other objects so it can "climb".
This is a species changing over time as it was originally a ground level plant but began to climb higher.
2 - Over many generations.
This is because diversity takes time and has to be integrated through generations; for instance, marriage. In a family, it becomes more diverse after the next generation as each generation is likely to marry someone of another ethnicity and allow the family tree to become more diverse.
3 - Mutate or Survive
It depends on what it means by mutate - develop a mutation to make it adaptable? If that's the case, then mutations within the DNA would be a result of adaptation and increase survival. Otherwise, survive is the obvious answer as adaption allows for species to move around and live longer.
Hope this helps!
Because it’s good for the environment to have a good balance and not to much of one thing
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
