1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anit [1.1K]
3 years ago
8

Zach is conducting an experiment to observe which type of fertilizer will allow a plant to grow the tallest. He puts three plant

s in identical pots and places them in the same location. He waters the plants each day with the same amount of water. Then, Zach measures the plant growth and records his observations.
Which of these is the control group in Zach’s experiment?

a) the growth rate of each plant
b) the pot that does not contain fertilizer
c) the type of fertilizer used in each plant
d) the amount of water given to each plant

Biology
2 answers:
Jobisdone [24]3 years ago
8 0

Answer:

the pot that does not contain fertilizer

Explanation:

solong [7]3 years ago
5 0

Answer: The answer is Pot that does not contain fertilizer

Explanation: I took the test

You might be interested in
3. Darwin surmised that all life on Earth was connected, like branches on a tree of life. What would the trunk of this tree repr
m_a_m_a [10]

Answer:

El árbol de la vida o árbol universal de la vida es una metáfora, modelo y herramienta de investigación que se utiliza para explorar la evolución de la vida y describir las relaciones entre organismos, tanto vivos como extintos, como se describe en un famoso pasaje de El origen de las especies (1859) de Charles Darwin.2

Explanation:

4 0
2 years ago
If locusts killed off most of the plants in a region the carrying capacity for most organsms would
aleksandr82 [10.1K]
The carrying capacity would *decrease*, as there are less plants for organisms to eat.
5 0
3 years ago
Hailey did 10 sets of sprints. When she relaxed afterward, her muscles started to feel sore. Which of the following best explain
Vitek1552 [10]

Answer:

Lactic acid from anaerobic respiriration

Explanation:

Hope it helps :D

7 0
3 years ago
Read 2 more answers
The nucleic acid base found in RNA but not in DNA is<br> ?
Yanka [14]

Answer:

its the uracil

Explanation:

the four nitrogen bases in dna are adenine, guanine, thymine, and cystosine. In rna, thymine is imply replaced with uracil

5 0
3 years ago
Read 2 more answers
Which of the following is false of the integumentary system? A. Too much UV radiation can mutate DNA in skill cells and cause ca
Taya2010 [7]

The statement which is false about the intergumentary system is option D. "Keratin is the pigment responsible for skin color."

Even though the skin color of human beings is affected y different substances, the pigment melanin is responsible for it. Melanin is produced within the skin in cells known as melanocytes and it determines of the skin color of darker-skinned humans.

For instance, the skin color of those who have light skin is determined primary by the bluish-white connective tissue placed beneath the dermis and by the hemoglobin which circulates in the veins of the dermis.

8 0
3 years ago
Read 2 more answers
Other questions:
  • In angiosperms, what is the name of the outer epidermal layer that protects the plant body?
    9·2 answers
  • When a newly formed cell enters into interphase and begins conducting metabolic functions, it is in _____.
    14·1 answer
  • Which two characteristics describe all organisms in the domain Eukarya?
    7·1 answer
  • How can the over harvesting of a single species affect an entire ecosystem?
    9·1 answer
  • Help me please I need to pass this test
    5·2 answers
  • Scientists use bacteria to make ________
    15·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • What are the enzymes called when they are at low temperature?
    8·2 answers
  • Why is salivary amylase active for only an hour or so, whereas lingual lipase isn't active until reaching the stomach
    8·1 answer
  • The main dietary factor associated with elevated blood cholesterol is?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!