1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
laiz [17]
3 years ago
5

Which of the following are products in a neutralization reaction? Check all that apply. A. A salt B. Water C. A base D. An acid

Biology
1 answer:
harkovskaia [24]3 years ago
8 0
Hey there,

Question: <span>Which of the following are products in a neutralization reaction?

Answer: Salt & Water

Hope this helps :D

<em>~Top♥</em>
</span>
You might be interested in
An oil company wants to set up its refinery in a town. Environmentalists are against this project, as it will pollute the nearby
attashe74 [19]
I think the answer is bribery, but oil drilling is vital to the USA economy so it should not have been banned in the first place.
3 0
3 years ago
Read 2 more answers
Some antibiotics can harm the ribosomes in animal cells. Which of the following would you predict to be the most likely long-ter
GalinKa [24]
Errors would be made during DNA replications, and cells would then be unable to grow and decide. This would be a long term effect because everything is made of cells.
7 0
3 years ago
Read 2 more answers
The traits of populations in the forest ecosystem have changed over time. What caused the traits to change?
Reil [10]
Natural selection is what caused them to change


8 0
4 years ago
When compared to prokaryotic cells, eukaryotic cells
Soloha48 [4]

Answer:

B. are complicated, larger, and have DNA captured in a membrane-bound structure.

Explanation:

DNA is found in the nucleus of the cell that is membrane bound structure.

8 0
3 years ago
Read 2 more answers
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Other questions:
  • What is the cause of tornadoes and thunderstorms.
    5·2 answers
  • Which of the following colors would indicate the coolest star
    7·2 answers
  • Indicate whether each of the following statements is true, false, or does not provide enough information for you to make a decis
    13·1 answer
  • You are observing a single cell under a microscope. you go home for the night, and the next day you see four cells. the four cel
    6·1 answer
  • Among cattle, having horns is a recessive trait. Cattle without horns, which are called polled cattle, are common. Suppose a hor
    9·2 answers
  • Tissue that carries messages throughout our bodies
    14·1 answer
  • Scientists want to know how our genes interact with our environment to make us who we are. This is the _____ question.
    14·2 answers
  • Most gymnosperms produce ___, while most angiosperms produce ___.
    11·1 answer
  • The lake at .8 in the diagram is one of the primary points of the charge for the offer. Assuming the maximum rate of recharge is
    14·1 answer
  • Could someone please help? IVE LITERALLY BEEN CRYING CUZ I CANT DO THIS
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!