1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ozzi
2 years ago
13

.How fast does the average snowflake fall?

Biology
2 answers:
inna [77]2 years ago
6 0
It typically falls four feet per second :)

-Aiden
lisov135 [29]2 years ago
4 0
Hello,

It differs, but there is an average of 1-6 feet per second. It depends on the snowflake's surface area and the mass.

Hope this helps!

May
You might be interested in
When non nerve cells become invoved in response to signals whitch tipe of receptor gose into action
inna [77]

The answer to the question is enzyme linked receptor.

6 0
3 years ago
What is photo synthesis?​
lisabon 2012 [21]

Answer:

The process autotrophs (plants) use to create food. they convert CO2 (Carbon Dioxide) and H2O (Water) into O2 (Oxygen) and glucose (sugar).

7 0
2 years ago
Read 2 more answers
List frog, bat, lobe- finned fish, and alligator in order of their relationship tp humans
SashulF [63]

<em>Homo sapien ((human))</em>

<em>Bat ((mammal))</em>

<em>aliigator ((reptilious))</em>

<em>Frog ((amphibious))</em>

<em />Fish

4 0
2 years ago
Above is a map that supports the idea that the continents were once joined together. Some fossils can be found on multiple conti
denpristay [2]
Can I see the map maybe I’ll be able to help ☝
8 0
2 years ago
Which terms best describes our atmosphere?
makkiz [27]

Answer:

c.dynamic, interacting,constantly changing

5 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • In your laboratory journal, describe the two tools of molecular biology that are often described as the scissors and glue for ma
    8·2 answers
  • Two students set up the following apparatus in a lab: a pipette was filled with a mixture of yeast and apple juice and inverted
    15·2 answers
  • State the number of processes that remove carbon dioxide from the air
    15·1 answer
  • The idea that all life is based on cells and that cells come only from other cells is known as the cell theory
    8·1 answer
  • Compare the function of the left and right side of the heart!<br> Thanks
    13·1 answer
  • What is the botanical name of pawpaw​
    11·2 answers
  • By favoring some alleles over others, natural selection can lead to survival advantages for some organisms. Which of the followi
    15·1 answer
  • A. Draw a food chain that could exist in your ecosystem.
    13·1 answer
  • Epigenetics may be defined as changes in the expression of a gene or set of genes by _______ and _______.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!