Answer:
The chromosomes begin to uncoil, which makes them diffuse and less compact. Along with telophase, the cell undergoes a process called cytokinesis that divides the cytoplasm of the parental cell into two daughter cells.
Just a few hours after the birth of a baby, the mammary glands start producing milk.
Prolactin is the hormone that stimulates this event!
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
1: ?
2. Deposition can move things such as sand & rocks so if moving enough of them it could create things maybe such as sand dunes
(idk I learned this a while ago so I'm not 100% sure)
3. well if you made something such as a hut or something out of rock/clay erosion could destroy it.
To form a peptide bond, you have to go through dehydration synthesis so as the name states, you remove a water molecule
