1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katen-ka-za [31]
2 years ago
10

Which of the following best explains why the Galápagos islands are still used for evolution research today?

Biology
1 answer:
kogti [31]2 years ago
5 0
Pretty sure it is D. Which makes it easier to study a group of species and find out what makes them flourish in that environment.
You might be interested in
What does it mean if someone is malnourished?
Goshia [24]
To be malnourished means to lack proper nutrients that keep you healthy say a person likes fast food and eats only fries for a long period of time they will lack nutrients and get sick which is the bodies way of saying you need to eat a variety of food.
6 0
2 years ago
Why is trash disposal a problem in industrialized nations?
Burka [1]

excess organic wastes


7 0
3 years ago
Read 2 more answers
A microbiologist is in the process of classifying a newly discovered organism. Its characteristics include:
dedylja [7]
Based on the characteristics you describe, this is most likely a type of fungi. 
4 0
2 years ago
Read 2 more answers
What is the unknown mineral most likely that has a density of 7.14
Gelneren [198K]
The answer would be iron
5 0
3 years ago
The inheritance of genetic traits from parents to children follows predictable rules knowing that each parent contributes Jane's
Karo-lina-s [1.5K]

both parents and family members determine eye color

8 0
3 years ago
Other questions:
  • The questions is in the questions, you will be reported for typing random stuff.
    12·2 answers
  • 1. What is the processes of leaves? 2. What is the adaptions in leaf?
    12·1 answer
  • Https://youtu.be/dz5WE3hgvBY
    6·1 answer
  • HURRY I NEED HELP QUICKLY. As part of an adventure challenge, you find yourself dropped into a unknown place. There are birds an
    11·1 answer
  • Sponges (phylum: Porifera) are animals that possess feeding cells called collar cells. These cells have a central flagellum surr
    14·1 answer
  • Hyftgyujikolp;hflgjhklpo[h
    7·2 answers
  • What is a polar molecule?
    13·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • ILL GIVE U BRAINLYIST
    7·2 answers
  • What structure is responsible for the process of photosynthesis?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!