1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sp2606 [1]
3 years ago
5

What are population pyramids? How do they help in understanding about the population of a country? (​

Biology
1 answer:
harina [27]3 years ago
6 0

Answer:

Did this help?

Explanation:

Population pyramid is the graphical presentation of the age, sex composition of a population. (2) The shape of the population pyramid help us to know about the people living in that particular country.

You might be interested in
9
nata0808 [166]
It’s true. have a great day/night!
5 0
3 years ago
Read 2 more answers
The organism isolated from the sprouts is oxidase negative, motile, ferments glucose and lactose, and cannot utilize citrate. wh
Ksenya-84 [330]
E. coli is a micro-organism while is mobile, and possess flagella for the same It has the ability to ferment both glucose and lactose. But it can not utilize citrate. It is a common food-borne pathogen, and can be present due to poor hygienic conditions, or water contaminations. 
 
6 0
4 years ago
What is a valuable mineral known for its beauty rarity or durability
kondaur [170]
Diamond!! it is often used for its hardness!
5 0
3 years ago
One of the most common household toxins, benzene can be found in the following:
Mashcka [7]
Air fresherners. paint supplies
4 0
3 years ago
Read 2 more answers
In the 1880s, Louis Pasteur developed a method of weakening viruses. The weakened viruses could be injected into healthy individ
nydimaria [60]

By injecting dead cells of the disease into the body, the body can analysis what it is supposed to be fighting off before it gets the active diseases. So if the body does actually get the disease then it knows how to fight it off and can have a better chance at doing it.

6 0
3 years ago
Other questions:
  • To bend a joint, one muscle _____ while another muscle returns to its original length. contracts extends vibrates lengthens
    12·1 answer
  • Which vitamins are made by the bacteria in the large intestine?
    12·1 answer
  • And on this to please science is driving me crazy
    13·2 answers
  • What part of the cell theory MOST implies that viruses, for all of their similarities to living cells, cannot be considered a li
    9·2 answers
  • Ally is a junior high student who has just learned about the carbon cycle in school. She is concerned about the environment and
    9·1 answer
  • What 2 ions are most common in both blood plasma & interstitial fluid?
    7·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • What is photo synthesis?​
    8·2 answers
  • Which step occurs in the e site of the ribosome during translation?.
    5·1 answer
  • EGR2 phosphatase regulates OST1 kinase activity and freezing tolerance in Arabidopsis. EMBO J. 38: e99819.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!