1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lubov Fominskaja [6]
3 years ago
12

With your partner list three biological processes involving biosynthesis break down what you think your body could carry out usi

ng the matter and energy from the beef burger
Biology
1 answer:
slamgirl [31]3 years ago
8 0

Answer:

Photosynthesis, chemosynthesis and ATP synthesis.

Explanation:

Photosynthesis, chemosynthesis and ATP synthesis are the three biological processes that involves biosynthesis break down. Beef burger having bread, meat and cheese which provides carbohydrates, proteins and fats to the body respectively. Carbohydrates are converted into glucose, proteins are converted into amino acids and fats are converted to fatty acids in order to absorb by the cells of the body.

You might be interested in
Which best explains how greenhouse gases heat the earth?
Rina8888 [55]
Hey there, whats up

the answer is: <span>they trap heat in the atmosphere, warming the planet



hope it helps ;) good luck
</span>
5 0
2 years ago
Read 2 more answers
Assume a physiologist has inserted a microelectrode into a neuron when it is at rest. The voltage recorded at the arrow tip will
Scorpion4ik [409]

Answer: -70 mV

Explanation:

Assume a physiologist has inserted a microelectrode into a neuron when it is at rest. The voltage recorded at the arrow tip will be <u>-70 mV</u>.

3 0
2 years ago
The diagram shows a section of DNA. What is the arrow labeled X pointing to? adenine thymine cytosine guanine
Schach [20]

Answer:

This is one example of a chimp DNA diagram

A G C T A C A G A G

A is Adenin

G is Guanine

C is Citosin

T is Thymine

Explanation:

Adenine

Adenine is an organic molecule found in DNA, ribonucleic acid (known as RNA) and adenosine triphosphate, better known as ATP.

Guanine

Guanine is a purine base found in DNA and RNA that binds exclusively with cytosine to form ribonucleosides called guanosine or deoxyribose to form deoxyguanosine.

Thymine

Thymine is a pyrimidine base found in DNA that binds to adenine.

Cytosine

Cytosine is a pyramid-shaped nitrogenous base that binds to guanine in RNA and DNA as nucleotides and functions as part of the genetic code.

#AnswerForTrees

5 0
3 years ago
Read 2 more answers
How are carbohydrate polymers formed?
Lostsunrise [7]
The are formed by cells building carbohydrates polymers, they use energy to form glycosidic linkages..the bonds between monosaccarides...which is made by joining two specific monomers, glucose and fructose.

8 0
3 years ago
What is selective breeding?
soldi70 [24.7K]

Answer:

A

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which soil would you espect to be better developed: the soil on a hillside or the soil on a valley floor? Why?
    5·1 answer
  • What kind of cell will you find in a leaf of a tree that you wouldnt find in a fingernail
    13·1 answer
  • Please help ASAP!! I need you guys/girls.
    6·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Chris is studying oxidation and reduction reactions. Which of the following could she use as an example of an oxidation reaction
    13·1 answer
  • A hypothesis becomes a theory:
    15·1 answer
  • Archaeplastida, which include red and green algae and land plants, are thought to have descended from a heterotrophic protist th
    10·1 answer
  • Which of these is the BEST way to assure a healthy animal stays healthy?
    5·1 answer
  • Length of an object under a microscope describes??​
    9·1 answer
  • ILL give brainliest what is the age of geological term?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!