Iron
A side note about haemochromatosis:
Haemochromatosis is a disease where there is too much iron is in the body. It is the most common form of iron overload disease. There are two types of haemochromatosis:
<span>
Primary haemochromatosis is a genetic disorder inherited from family members. People with this condition absorb too much iron and it ends up accumulating in the body, especially in the liver. </span><span>
Secondary haemochromatosis is caused by other blood-related disorders such as anaemia, or may be due to many blood transfusions, long term alcoholism and/or other health conditions. </span><span>If left untreated, iron overload can lead to liver damage. That’s why it’s important to receive treatment as soon as possible after diagnosis to prevent further complications, including liver disease, liver cirrhosis, liver failure, liver cancer, heart disease, arthritis or diabetes. Some organ damage can be reversed if detected early enough and treated appropriately.
</span><span>
cigarettes
If you smoke cigarettes there’s a chance that you are causing damage to your liver – increasing your risk of developing liver cancer and decreasing your liver’s ability to rid your body of dangerous toxins. In turn, this could leave you more susceptible to the damaging effects of some medications on the liver too. </span>
Answer:
oxygen and glucose
your welcome i hope this helps
Explanation:
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
