1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jlenok [28]
2 years ago
14

Since 1990, at least thirty new emergent human diseases have been identified. These include avian influenza, West

Biology
1 answer:
Snezhnost [94]2 years ago
8 0

Answer:

2 per year

Explanation:

You might be interested in
Scientists have found 2 frameshift mutations in patients with Cystic fibrosis. This condition is very serious and without the pr
Makovka662 [10]

Answer:

b

Explanation:

6 0
3 years ago
What is the name of the membrane that lines the eyelids and covers the outer surface of the anterior sclera?
Mariulka [41]
Conjunctiva lines the eyelids and covers the anterior sclera
3 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Describe the epithelium found in the uterine tube.
rewona [7]

Answer:

A ciliated secretory epithelium lines the uterine tube.

5 0
3 years ago
Which of the following statement is true about the structure of DNA?
Zarrin [17]

Answer:

info?

Explanation:

3 0
3 years ago
Other questions:
  • ) when two aqueous solutions that differ in solute concentration are placed on either side of a semipermeable membrane, and osmo
    14·1 answer
  • The sun is the primary source
    8·1 answer
  • Proteins can perform many different functions in living cells one major function acting as a catalyst for chemical reactions can
    7·1 answer
  • Which macromolecules are often made of three fatty acid‘s bond to a glycerol molecule.
    5·2 answers
  • What do scientists think was the first rna that led to life
    10·1 answer
  • I will mark BRAINLIEST! I have this science portfolio where I draw a car, I need to use renewable resources that will make sense
    12·1 answer
  • In some plants, flower color, or __________ of the plant, is dependent upon environmental factors such as the acidity of soil. A
    14·1 answer
  • Formation of a Fertilized Egg Gametes are formed by meiosis Egg (n) – Ovary Sperm (n) - Testis –gametes join together in the _Zy
    14·1 answer
  • PLEASE HELP!!!!! 40 pts!!!
    7·2 answers
  • After nitrogen is removed from the amino acids in protein-containing foods, the remainder of the amino acids can enter aerobic r
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!