1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kozerog [31]
3 years ago
8

When we ingest large molecules such as lipids, carbohydrates, and proteins, they must undergo catabolic reactions whereby enzyme

s split these molecules. this series of reactions is called ________.
a. chemical digestion
b. secretion
c. mechanical digestion
d. absorption?
Biology
1 answer:
SIZIF [17.4K]3 years ago
5 0
A. chemical digestion:
it the type of digestion which occurs due to enzymes start right from the mouth with help of amylase enzyme. some of it occurs in stomach, but the major part complete in small intestine.

b.secretion:
it is the phenomenon of release of enzyme, hormones and some salt in case of digestion.

c. mechanical digestion:
it is that type of digestion which occurs due to teeth, in which large food is broken down into small pieces to form bolus.

d. absorption:
it is the process in which food molecules are absorbed in villi in intestine.

Answer:
the correct option is a (chemical digestion).
You might be interested in
Since beans contain the essential amino acid methionine, beans are considered complete protein sources.
Leni [432]
The above statement is false.
A complete protein is a source of protein that contains an adequate proportion of all nine essential amino acids necessary for the dietary needs of humans.
For example, meat, seafood, eggs and dairy are all complete proteins, while plant foods like beans, whole-grains and brown rice are incomplete proteins.
6 0
4 years ago
Read 2 more answers
How do cellular respiration and photosynthesis work together?
Igoryamba
Well, photosynthesis makes the glucose that is used in cellular respiration to make ATP

hope that helped!
7 0
3 years ago
How do insects contribute beneficially to agriculture?
erastovalidia [21]
They pollinate plants, which saves farmers work. Insects such as bees and butterflies help to pollinate plants. 
4 0
4 years ago
In most medical procedures hazardous waste is produced this waste is usually burned, which can release chemicals like mercury in
Tcecarenko [31]

Answer:

creation of a burning chamber which will suppress the chemicals released into a usable form.

Explanation:

hope it helps .

4 0
3 years ago
Can someone summarize The dual visual system to me AND color vision, like blindness etc...
Oduvanchick [21]

Dual visual system:

Dual visual system is nothing but the different visual systems that our brain is meant to direct.

The two visual systems are

  • Dorsal Stream
  • Ventral Stream  

Dorsal Stream:

Dorsal stream is mainly referred as a vision of action. This visual system is involved in moment by moment analysis. It is also known as where stream.

Ventral Stream:

Ventral stream is mainly referred to as the vision of perception. This visual system is meant to analyse and recognize shape and object etc. It is also known as What stream

Blindness:

Blindness is a defined as the lack of vision. Such type of vision loss can't be corrected either by contact lens or through glasses.

There are two type of blindness,

  • Temporary Blindness
  • Permanent Blindness

Temporary blindness is a condition where the vision of an individual vision is limited.

Permanent Blindness is a condition where an individual can't see anything even the light

8 0
3 years ago
Other questions:
  • Which of the following is not required for the proper use of molecular beacons?
    11·1 answer
  • Scientists can use genetic information to identify people because it is unique to each person. Which specific characteristic is
    11·1 answer
  • A fat is called ____ of all carbons of the fatty acid chain are single bonded
    10·1 answer
  • If a person has Type A blood which blood types can receive this persons blood?
    13·1 answer
  • Why do mosquito bites itch?
    9·2 answers
  • How does a pH of 3 differ from pH of 4? Which one is stronger or weaker? By How much?
    6·1 answer
  • What are the three types of symbiosis?
    12·1 answer
  • What is the hardness of copper and aluminum
    9·1 answer
  • HELP<br><br><br><br> Which bodily system is responsible for releasing growth and other hormones?
    8·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!