1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivanshal [37]
3 years ago
6

You have learned that scientists have found physical evidence of the Flood. In this project you will think about Noah and his co

nstruction of the ark.
​

Pretend that you are a newspaper reporter, and you are able to interview Noah. Then write a newspaper article about your interview.



Answer these questions.

What kinds of questions would you ask him?



Write a news article on your interview with Noah. (100 words or more is fine)
Need help asap just answer write the article the first 1 i already answered just copy pasted the questions
Biology
1 answer:
mart [117]3 years ago
7 0

Answer:

We got a chance to speak to Noah the Ark builder. Many people of the town have been wondering what Noah has been building lately. We asked him what was his objective and he said "A great flood like no other will come, water from the sea will fall from the air. Whoever is in the ark shall be safe. Two of each type of animal on earth shall come to my ark for shelter. The storm will be so great it will knock out all who does not inhabit the ark."It is hard to understand what he means by these statements but who knows maybe his boat will take him somewhere. The people of the town have been calling him insane, since no one would need a boat that big.

(I'm guessing that you mean the interview was before the flood since everyone died after.)

You might be interested in
A group of scientists are studying the effects of different fertilizers on the growth of pea plants. They began their study with
katrin [286]
A control group of the experiment is the one in which no treatment or intervention is given. So, in your case, the pea plants in which was not subjected any of the fertilizers, will serve as a control group. This is a negative control. A positive control group is the one in which an established treatment is given, which definitely leads to the production of the desired character. So, in your case, a very good well-known fertilizer which has a positive control on the growth of the pea plant, would serve as a positive control.
8 0
3 years ago
HELP BIOLOGY 50 POINTS !!!!!!
Rus_ich [418]

Answer:

1. lactose intolerant

2. lactase

3. dairy products

4. e.coli

5. enzymes

6. protein

7. repressor

8. operator

9. rna polymerase

10. transcribe

11. bases

12. repressor

13. operator

14. transcription

7 0
2 years ago
What type of energy is represented by turning the crank on the ice cream freezer?
marshall27 [118]
Answer: Mechanical energy
7 0
3 years ago
Read 2 more answers
The function of enzymes is to -
Alborosie
The answer is B) change the rate of reaction
4 0
3 years ago
Hello, can someone please help me with this!
satela [25.4K]

Explanation:

Reconstruction was the period in the united states during which the Civil war took place and the laws were made to provide equity to the slaves ending slavery.

The problem arises due to the reunion of the 11 states of the South to the Union which seceded earlier.  Slavery was more practised in the Southern states compared to Northern states.

The Republican party did corruption from 1869 to 1877 which allowed due to which they lost their election of 1877.

In 1877, a special electoral commission was established in favour of Hayes and Democrats took benefits of this condition.

When Hayes was selected, he withdrew the federal troops from the South which allowed the Democrats to gain their seats in South and ended Reconstruction.

8 0
3 years ago
Other questions:
  • An estuary is an example of a marine biome
    15·1 answer
  • An energy company wants your help to reduce their use of fossil fuels by utilizing a light source. how can research into chlorop
    13·1 answer
  • A scientist is analyzing tissue samples from an Asian elephant and an extinct woolly mammoth. When he sequences their DNA, he fi
    9·1 answer
  • All of the following affect water table depth EXCEPT
    10·2 answers
  • What is a pickle food group​
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • When too much water is accumulated in the soil it surfaces known as
    9·2 answers
  • Which statement most accurately describes human skeletal muscle
    7·1 answer
  • Unlike b cells, t cells do not display antigen receptors on their surface membranes
    6·2 answers
  • How are the lysogentic and lytic cycles different?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!