1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enot [183]
2 years ago
9

What would be the immediate consequence if a neurons sodium-potassium pump was disrupted?

Biology
1 answer:
Andrej [43]2 years ago
4 0

Answer:

Option A.

Explanation:

The sodium pump in the neuron is electrogenic,there are three Na+ from every K+ that enter the cell . If there is a blockage to all sodium pump activity in a cell, there would be an instant change in the membrane potential which will not allow the action potential to take place because a hyperpolarizing current was removed, which means that the membrane potential becomes less negative. Therefore the electrogenic contribution of the sodium pump to the membrane potential will be small which lead to small depolarization.

You might be interested in
Which adaptation helps polar bears maintain a constant internal temperature (thermal homeostatsis) in cold weather?
ANEK [815]

Answer:dude your cool

Explanation:

8 0
3 years ago
Membrane phospholipids
Vsevolod [243]

Answer:

Option-C

Explanation:

The phospholipids are the major constituents of the cell membrane of a cell. The phospholipids contains the glycerol attached to the phosphate group and forms the hydrophilic heads whereas the fatty acid tails from the hydrophobic portion of the membrane.

The hydrophobic head face outwards whereas the tails face inwards.  The structure of the membrane as arranged in bi lipid layer form and in such a way that the membrane molecules can move.  The other molecules present in the membrane like the proteins can drift in the membrane.

Thus, Option-C is correct.

5 0
3 years ago
Which gender realeses its seeds for new ganetophytes to grow for conifers
nata0808 [166]
Females do I think sorry if I got it wrong mate
5 0
3 years ago
Why DNA is absent in blood plasma?
Keith_Richards [23]

Answer:

Red blood cells and blood plasma do not contain DNA. Red blood cells don't have the DNA containing nucleus and mitochondria. Only white blood cells in blood contain DNA. With blood donation, usually most of the white blood cells are filtered out.

Explanation:

because red blood cells don't have the DNA containing nucleus and mitochondria

3 0
2 years ago
List 5 ways we can help the ocean and the organisms living in it.
mamaluj [8]

Answer:

1. Reduce Pollutants

2. Conserve Water

3. Eat sustainable seafood

4. Don't purchase items that exploit marine life

5. Don't throw trash into the ocean

Hope this helps :)

8 0
2 years ago
Read 2 more answers
Other questions:
  • Suppose that a carrier of familial Down syndrome mated with a person with a normal karyotype. Which gamete from the carrier pare
    8·1 answer
  • Name two reasons that affect humidity
    12·2 answers
  • When considering maintenance of a healthy weight, nutrient needs are affected by all of the following except
    5·2 answers
  • Where the ocean would you expect to find the largest % of dissolved gases ?
    15·1 answer
  • Which is an example of foraging as a benefit of social behavior?
    6·1 answer
  • What is the purpose of oxygen in cellular respiration?
    8·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • How is 100,000,000 written in scientific notation? Need a Hint? A) 1 x 1008 B) 1 x 100 000 000 C) 1 x 108 D) 1 x 10-8
    12·2 answers
  • What property of water is NOT caused by hydrogen bonding between water molecules?
    10·1 answer
  • If an atom has 15 electrons, how many electrons are in the n=1 energy level?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!