1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serggg [28]
3 years ago
11

This is the part of a flower that helps attract animals in order to aid in pollination.

Biology
1 answer:
tino4ka555 [31]3 years ago
3 0

Answer:

Petals?

Explanation:

:)

You might be interested in
Animals with cephalization usually have Select one: A. radial symmetry B. only 2 germ layers C. bilateral symmetry D. a digestiv
amid [387]
C. bilateral symmetry
8 0
3 years ago
Which type of direct increases glycogen stored in muscle and endurance time at marathon speed most? high fat mixed high carbohyd
tino4ka555 [31]

The  type of direct that increases glycogen stored in muscle and endurance time at marathon speed most is high carbohydrate. Option C.

<h3>What is glycogen?</h3>

The term glycogen refers to the form in which carbohydrate is stored in the body. The energy that is stored as glycogen in the body can be slowly released when required by hydrolysis of the glycogen molecule.

The  type of direct that increases glycogen stored in muscle and endurance time at marathon speed most is high carbohydrate. Option C.

Learn more about glycogen:brainly.com/question/14466525

#SPJ4

Missing parts;

Which type of direct increases glycogen stored in muscle and endurance time at marathon speed most? A. high fat B. mixed C. high carbohydrate D. fasting

4 0
2 years ago
Examine the words and/or phrases below and determine the relationship
gizmo_the_mogwai [7]
Natural gas

explanation:
solar power, coal, and petroleum are used to power things (i.e. produce electricity)
3 0
3 years ago
DNA double helix does not have which of the following?
Rina8888 [55]

Answer:

Uracil

Explanation:

  • Uracil is only found in RNA
  • It replaces Thymine during transcription and base pairs with adenine
4 0
3 years ago
The area between Z lines is the
Nataly_w [17]

Answer:

Sarcomere

Explanation:

A myofibril or muscle fiber under an electron microscope shows alternate light band and dark bands.  These bands give the skeletal muscle and cardiac muscle a striated appearance. The light band is called the I- band or isotropic band, and the dark band is known as A- band or anisotropic band. In the center of the I-band Z-line is present. It is discovered from a German term Zwischenscheibe (between the disc). The portion of myofibril between one Z-line to the next Z-line is called sarcomere.

3 0
3 years ago
Other questions:
  • Select all of the statements that apply to healthcare-associated or nosocomial pneumonia to test your understanding of the diffe
    5·1 answer
  • Table salt is a compound that is made from an equal number of chlorine atoms and sodium atoms bonded together. Which of the foll
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of these could you find in the benthic zone of a lake?
    5·1 answer
  • The most common source of activity limitation in early adulthood is
    9·1 answer
  • What part of the brain controls involuntary actions
    15·1 answer
  • Which factor may help begin an ice age? Select all that apply
    10·1 answer
  • Can the volume displacement method be used for calculating the volume of unsinkable solids?
    10·1 answer
  • What are the three most important functions that a cell performs?
    13·1 answer
  • The difference between the human nervous system and the endocrine system is that
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!