1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Masja [62]
3 years ago
8

The cross over frequency between linked genes C and D is 40%; between A and D is 35%; between C and A is 5%; between A and E is

25%; and between E and D is 10%. Construct a linkage map of these 4 gense and show the distances between the adjacent genes.
Biology
1 answer:
nlexa [21]3 years ago
8 0

Answer: The first line shows the Correct order of genes in the chromosome and the second and third lines show the distances between genes.

C ------------ A ---------------------------------- E -------------------- D (Correct order)

/-----5MU--//---------------25 MU-----------//---------10MU-----/  (Distances)

/------------------------------------40 MU ------------------------------/   (Total distance)

Explanation:

We need to know that 1% of recombination frequency = 1 map unit = 1cm. And that the maximum recombination frequency is always 50%.  

The map unit is the distance between the pair of genes for which every 100 meiotic products, one results in a recombinant one.  

The recombination frequencies between two genes determine their distance in the chromosome, measured in map units. So, if we know the recombination frequencies, we can calculate distances between the four genes in the problem and we can figure the genes order out. This is:

Recombination frequencies:  

1% of recombination frequency = 1 map unit (MU)

C-D = 40% = 40 MU

A-D = 35% = 35 MU

C-A = 5% = 5 MU

A-E = 25% = 25 MU

E-D = 10% = 10 MU

Now that we know the distances between pairs of genes, we need to figure out which is the correct order in the chromosome.

C and D are the genes with the biggest distance between them (40MU), which probably means they are in the extremes. The rest of the genes are in the middle.

C ------------------ (40MU) --------------------------------------- D

A is 5 MU apart from C and 35 MU apart from D, which means it is closer to C.

C------ (5MU)----A------------------------------(35 MU)-------D

E is 25 MU apart from A and only 10 MU apart from D, which means it is between A and D, and closer to D

C--------------------A------- (25 MU)---------E----(10MU)-----D

The sum of C-A distance + A-E distance + E-D distance equals the C-D distance. This is:

C-A 5MU + A-E 25MU + E-D 10MU = C-D 40 MU

5 + 25 + 10 = 40

In conclusion, the correct order of the genes in the chromosome is

C ------------ A ---------------------------------- E -------------------- D

/-----5MU--//---------------25 MU-----------//---------10MU-----/

/------------------------------------40 MU ------------------------------/

You might be interested in
In Pepperland, occupational success (measured by salary) is inversely proportional to the quantitative trait, "BlueMeanie-ness".
shtirl [24]

Answer:

Please see below

Explanation:

First of all we need to examine and rank all BlueMeanie-ness scores from the Pepperlanders who took the test.

Ranked scores (from lowest to highest):  8.85; 10.80; 62.98; 88.07; 90.50.

Since the rationale is: occupational success is inversely proportional to the BlueMeani-ness score, it follows that the lower the score, the higher the occupational success, measured by salary. Therefore, the individuals with their scores on the low end will have a higher salary and the individuals with the higher scores will have a lower salary.

Conclusion: The individuals with scores 8.85 and 10.80 will likely have the higher wages.

7 0
3 years ago
a mother has one allele for color blindness and one allele for normal vision. what is the probability that her gamete will have
Murljashka [212]
The answer to your question is one half.
4 0
3 years ago
Read 2 more answers
What is the mRNA transcript if the complementary DNA is TCTGAG?
Ghella [55]

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

3 0
2 years ago
Polysaccharides are made of?
stellarik [79]

Answer:

b. Many glucose molecules

Explanation:

poly means many

7 0
3 years ago
Read 2 more answers
A river has several different industries along its banks, polluting its waters. How will this impact Earths other systems?
Alex

Answer: Pollution will move with water, disrupting other ecosystems.

8 0
2 years ago
Other questions:
  • ____ is the transportation system through the body.
    11·1 answer
  • Rosalind Franklin's x-ray diffraction images of DNA gave James Watson and Francis Crick information about DNA's
    9·1 answer
  • How can genetic engineering benefit the agricultural industry​
    14·1 answer
  • If normal cells are compared to cancerous cells, there will be a _________ (higher or lower) mitotic index in cancerous cells.
    8·1 answer
  • In three (3) sentences, explain the function of a vacuole in plant cells.
    12·2 answers
  • Is it the protein,organelles, or wastes?
    9·1 answer
  • Where does the water goes to first in a plant
    9·2 answers
  • What is the most important reason that sediments at beaches are usually rounded and smooth?
    9·1 answer
  • True or false:
    8·1 answer
  • Should The characteristics of life be redefined?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!