1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
telo118 [61]
3 years ago
15

Chemical reaction equations, such as the one for photosynthesis, show the reactants and products of a reaction. How does this si

mplification misrepresent what takes place during the process of photosynthesis?
It does not show where in a cell photosynthesis occurs.
It does not show how long photosynthesis takes to happen.
It does not show that photosynthesis consists of many separate reactions.
It does not show the number of molecules required to produce glucose.
Biology
2 answers:
slava [35]3 years ago
6 0
I would say the third option is the correct one. Although another simplification that the photosynthesis equation leaves out is the requirement of light energy needed to make glucose.
Natali5045456 [20]3 years ago
5 0

The right answer is It does not show that photosynthesis consists of many separate reactions.

It takes six molecules of carbon dioxide and six molecules of water to synthesize a molecule of glucose, releasing six molecules of oxygen, thanks to the light energy.

6 CO2 + 6 H2O + light energy ==> C6H12O6 (glucose) + 6 O2


<u>But this balance is in fact broken down into two successive stages:</u>

Light phase or photochemical phase:

12 H2O + light ==> 6 O2 + chemical energy (24 H).

The Calvin cycle (dark phase):

6 CO2 + chemical energy (24 H) ==> C6H12O6 + 6 H2O.

You might be interested in
The area shown on this geologic map is influenced by faults, as indicated by the red arrow near the number 5. What is the genera
nadya68 [22]
I pick c. because I really can't see the screen very well.
4 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Which is a characteristic of plants? They are unicellular. They are made up of prokaryotic cells. They have chloroplasts. They p
eimsori [14]
They have chloroplasts. They do not possess mobility because they cannot just stand up and walk to the nearest river. Unicellular organisms are very small, and most organisms are multi-cellular, including plants. Plants, animals, and fungi are eukaryotic, but only bacteria is prokaryotic. So therefore, choice 3 is correct.
7 0
4 years ago
Read 2 more answers
Assume that life on Earth began 3.5 billion years ago. To the nearest percent, how much of this time have anthropoids been livin
Crazy boy [7]

Answer:

Anthropoids lived for approximately 0.86% of the total time.

Explanation:

  • Anthropoids are the higher developed organisms that includes apes and ape mans.
  • The age of earth is 3500 million and anthropoids lived for about 30 million years.
  • By the simple calculations we can find out the data in percent which gives us the result nearest to 0.86%.
  • That means 0.86% of 3.5 billion year is equivalent to 30 million years (time that was lived by anthropoids).
4 0
3 years ago
How does a multicellular organism maintain homeostasis?
Sholpan [36]
The cells of multicellular organisms become specialized for particular tasks and communicate with one another to maintain homeostasis. Specialized cells in multicellular organisms are organized into groups.
7 0
3 years ago
Other questions:
  • LESSON 5: bio 1A Cells and homeostasis
    14·2 answers
  • Succession is _______. a. harmful to ecosystems b. a natural recovery process c. unnecessary for ecosystem recovery d. a one-tim
    13·2 answers
  • What would go wrong if a cell did not replicate its DNA before beginning mintosis?
    13·1 answer
  • Which organelle determines the structural and functional characteristics of the cell by controlling rna and protein synthesis?
    14·1 answer
  • Plz help ASAP!<br><br><br> Which phrase best describes the dependent variable in an experiment?
    14·1 answer
  • A steady activity in which your heart supplies oxygen to help fuel your muscles is
    5·1 answer
  • What is the largest reptile?
    14·2 answers
  • 1
    7·1 answer
  • How do we utilize energy resources from the residential sector?(should be 3-5 sentences)
    10·1 answer
  • Use complete sentences to explain how the mass of carbon is conserved during cellular respiration.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!