1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paha777 [63]
2 years ago
5

Explain the relationship between crossing over and genetic variation.

Biology
1 answer:
riadik2000 [5.3K]2 years ago
8 0

Explanation:

crossing over is a process that happens between human organs chromosome in order to increase general diversity. during crossing over part of one chromosome is exchange with another. the result is a hybrid chromosome with a unique pattern of genetic material. gametes gain the ability to be genetically different from their neighbouring gametes after crossing over occurs. this a loss for genetic diversity which will help cell participate in survival of the fittest and the evolution.

You might be interested in
If an organism is deprived of oxygen, could glycolysis still occur in its cells?
ivolga24 [154]

Answer:

No

Explanation:

because fermentation cannot occur without oxygen as a final electron acceptor.

3 0
2 years ago
A geologist finds four layers of sedimentary rock. She determines that no geological events have shifted the layers. She labels
kondaur [170]
The answer is “B is younger than D”
5 0
3 years ago
Read 2 more answers
Scott has to memorize 25 words.He had memorized 15 out of 25 words.What will the answer's be in a fraction?
HACTEHA [7]

since he memorized 15, he has only 10 left. so it should be 10/25

4 0
2 years ago
Read 2 more answers
Describe the temperate coniferous forest I give brainleist for first anwser
amid [387]

Answer:

Temperate coniferous forest is a terrestrial biome defined by the World Wide Fund for Nature. Temperate coniferous forests are found predominantly in areas with warm summers and cool winters, and vary in their kinds of plant life.

8 0
2 years ago
When eaten, nearly 90% of our dietary calories from fat are in the form of?
Alecsey [184]
Foods that people like
5 0
3 years ago
Other questions:
  • Like all sciences, forensics using the scientific method to reach conclusions. However, in forensics, this method is followed a
    15·1 answer
  • The tissue in the wall of the heart contracts
    5·1 answer
  • Oil glands are also called
    12·2 answers
  • Which layer of soil is the most newly formed? A. subsoil B. humus C. topsoil D. bedrock
    10·2 answers
  • . SUICI<br> 5. The female structure of a flower is the
    14·1 answer
  • What other traits are highly variable like human skin color ?
    11·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What is created when animals do anaerobic respiration (the stuff that makes your
    11·1 answer
  • 12.36Un balón lleno contiene 12 kg de oxígeno, O2, bajo una presión ma-nométrica de 40 atm. Determine la masa de oxígeno que se
    9·1 answer
  • What is the biggest job that nucleic acids have
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!