1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solniwko [45]
3 years ago
6

By which process does carbon dioxide enter a plant?

Biology
2 answers:
Romashka [77]3 years ago
8 0

Answer:

Photosynthesis

Explanation:

Plants get the carbon dioxide they need from the air through their leaves. It moves by diffusion through small holes in the underside of the leaf called stomata . Guard cells control the size of the stomata so that the leaf does not lose too much water in hot, windy or dry conditions.

adoni [48]3 years ago
3 0

Answer:

photosynthesis

Explanation:

mark brainliest

have a great day

You might be interested in
Column D: Which organism(s) eat this organism? (There could be many, but just list one or two.)
alexira [117]
Bacteria eats other bacteria
8 0
2 years ago
If two individuals have a certain phenotype, does that mean they must have the same genotype?
eduard

Answer:

No.As we know that phenotype depends on physical appearance whereas genotype is genetical materials. So person having same phenotype doesn't mean they have same genotype.

5 0
3 years ago
For each genotype below write whether it is homozygous or heterozygous
Yuki888 [10]

Answer: H O homozygous

Explanation:

4 0
3 years ago
The popsicle you are eating starts melting. Which of the following is correct regarding the situation?
Evgen [1.6K]
The popsicle gains thermal energy and the particles speed up.
5 0
2 years ago
What Organism is most likely 50 meters in size<br><br> .Lizard<br> .Bacteria<br> .tree<br> .ant
max2010maxim [7]
The correct answer is lizard hope this helps
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which planets are classified as terrestrial? Jupiter, Saturn, Earth, and Mars Mercury, Venus, Earth, and Neptune Jupiter, Saturn
    7·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A population of gray foxes lives in a forest ecosystem. These foxes prey mostly on a large population of mice. If a fatal diseas
    6·2 answers
  • **SOCIOLOGY** According to structural functionalists, modernization results in:
    15·2 answers
  • I'll mark Brainliest
    11·1 answer
  • Use the Internet to research and write a short report on a disease affecting one of the systems in the human body. Your report s
    14·1 answer
  • Water pollutants in rivers can be removed by
    15·1 answer
  • Your friend is trying to learn about how to kill bacteria. She reads the preservatives such as citric acid are added to foods be
    11·1 answer
  • E
    9·2 answers
  • Sarah recently learned that o2 is found in the earth’s water bodies. she was amazed to know the proportion of o2 found in the oc
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!