Which organism is made up of cells that have both a cell membrane and a cell wall?

2 answers:

8 0

Though most prokaryotes have both a cell membrane and a cell wall, there are exceptions such as Mycoplasma (bacteria) and Thermoplasma ( archaea ) which only possess the cell membrane layer. The envelope gives rigidity to the cell and separates the interior of the cell from its environment, serving as a protective filter. Hope this helped!

creativ13 [48]3 years ago

4 0

Plantas because they have both a cell wall and a cell membrane

You might be interested in

Not all members of a species are the same. Every species exhibits

UkoKoshka [18]

Idk the options but it could be genetic variation

6 0

3 years ago

What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT

Kazeer [188]

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.

8 0

3 years ago

Read 2 more answers

How does green house gas effect the ecosystem

BigorU [14]

Answer:

Explanation:

Global warming is the increase in the Earth's temperature caused by the buildup of greenhouse gases in the atmosphere such as carbon dioxide, methane, and nitrogen. The absorbed energy warms the atmosphere and the surface of the Earth.

6 0

3 years ago

A 4-year-old child arrives at the clinic with his mother. The mother tells you that she recently moved in with her new boyfriend

son4ous [18]

<h3>OHHHHHH KICK KICK KICK KICK KICK KICK </h3><h3>.........</h3><h3>...............</h3><h3>OHHHHHH KICK KICK KICK KICK KICK KICK</h3><h3>...........</h3><h3>.......................</h3><h3>.....</h3><h3>TWICE OvO</h3><h3>...........</h3><h3>.............</h3><h3>.......</h3><h3>HAAAAAIIIIIIIII LORENA </h3><h3>:D</h3>

3 0

3 years ago

What happens to the body when motor neurons are injured?

spayn [35]

ANSWER:

Lesions are areas of damage to motor neurons. Damage to upper motor neurons stops the signals your muscles need to move. When your muscles don't move for a long time, they become weak and stiff. Over time, it can become harder to walk and control your movement.

Explanation:

I hope it will help you

5 0

3 years ago